Mutagenetix > Incidental Mutation

Incidental Mutation 'R1696:Abca17'

192286

Institutional Source

Beutler Lab

Gene Symbol

Abca17

Ensembl Gene

ENSMUSG00000035435

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 17

Synonyms

MMRRC Submission

039729-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1696 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24264259-24351029 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24267658 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1465 (Y1465C)

Ref Sequence

ENSEMBL: ENSMUSP00000112538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]

AlphaFold

E9PX95

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039324
AA Change: Y1465C

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: Y1465C

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
transmembrane domain	22	44	N/A	INTRINSIC
Pfam:ABC2_membrane_3	252	464	9.5e-17	PFAM
AAA	547	729	5.71e-12	SMART
low complexity region	846	857	N/A	INTRINSIC
Pfam:ABC2_membrane_3	905	1307	6.7e-35	PFAM
low complexity region	1337	1351	N/A	INTRINSIC
AAA	1393	1577	1.15e-1	SMART
low complexity region	1697	1730	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121226
AA Change: Y1465C

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: Y1465C

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
Pfam:ABC2_membrane_3	21	464	1.2e-15	PFAM
AAA	547	729	5.71e-12	SMART
low complexity region	846	857	N/A	INTRINSIC
Pfam:ABC2_membrane_3	905	1307	1.1e-32	PFAM
low complexity region	1337	1351	N/A	INTRINSIC
AAA	1393	1577	1.15e-1	SMART
low complexity region	1697	1730	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	A	G	7: 27,560,597	T25A	possibly damaging	Het
Adgrb1	C	T	15: 74,588,107	R530W	probably damaging	Het
Ak9	A	G	10: 41,327,589	T159A	possibly damaging	Het
Akap13	G	A	7: 75,609,592	G655S	possibly damaging	Het
Amer2	T	A	14: 60,379,674	D439E	possibly damaging	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Arfgef2	T	A	2: 166,861,638	M870K	probably damaging	Het
Arhgef33	T	C	17: 80,349,506	F150S	probably damaging	Het
Arid2	A	T	15: 96,370,183	T726S	probably benign	Het
Atf7ip2	G	A	16: 10,234,331	V225I	probably damaging	Het
Atp12a	A	T	14: 56,366,088	E50V	probably damaging	Het
Bdkrb1	A	G	12: 105,604,502	N109S	probably benign	Het
Cald1	A	G	6: 34,745,711	E104G	probably damaging	Het
Capn15	A	G	17: 25,964,904	V267A	probably benign	Het
Ccng2	A	T	5: 93,273,382	K250N	possibly damaging	Het
Ccr10	T	A	11: 101,174,384	N107Y	probably benign	Het
Cntn2	T	C	1: 132,521,279	N664S	probably damaging	Het
Cyp24a1	T	G	2: 170,486,043	E426D	probably benign	Het
Cyp26a1	A	G	19: 37,701,178	S441G	probably benign	Het
Cyp4f14	T	A	17: 32,909,171	K290M	possibly damaging	Het
Dcp2	T	A	18: 44,400,324	L114Q	probably damaging	Het
Dhrs7	A	G	12: 72,653,120	F246S	possibly damaging	Het
Dlg1	T	C	16: 31,781,798	V167A	probably damaging	Het
Dnmt3b	A	T	2: 153,676,710	K598*	probably null	Het
Dph7	T	C	2: 24,969,680		probably null	Het
Ehbp1	T	C	11: 22,053,441	M1103V	probably damaging	Het
Ell2	T	C	13: 75,769,558	S536P	probably damaging	Het
Ero1l	A	T	14: 45,299,935	V178E	probably damaging	Het
Faf2	T	A	13: 54,638,254	*50R	probably null	Het
Fbxl14	A	T	6: 119,480,146	N96I	probably damaging	Het
Fcrls	T	C	3: 87,259,518	Y56C	possibly damaging	Het
Foxc1	T	A	13: 31,808,799	M531K	unknown	Het
Foxp1	A	C	6: 98,945,702	S391A	probably benign	Het
Frem2	A	T	3: 53,656,042	L348*	probably null	Het
Fsd1	T	A	17: 55,988,257		probably null	Het
Gab2	A	G	7: 97,223,633	E81G	probably damaging	Het
Gcat	G	A	15: 79,035,795	V196M	probably damaging	Het
Gfy	T	C	7: 45,178,046	T209A	possibly damaging	Het
Ggt7	T	C	2: 155,494,979	N531S	possibly damaging	Het
Gnai3	A	G	3: 108,109,459	I343T	probably damaging	Het
H2-DMa	A	T	17: 34,138,413	Q220L	probably benign	Het
Heatr1	A	G	13: 12,423,721	I1346V	possibly damaging	Het
Igfbp1	T	C	11: 7,201,922	W242R	probably damaging	Het
Igfbp1	T	A	11: 7,197,978	V7D	probably benign	Het
Kbtbd2	T	G	6: 56,779,341	K470T	probably benign	Het
Klb	G	C	5: 65,348,746	R112P	possibly damaging	Het
Klhl25	G	T	7: 75,866,843	G499V	probably damaging	Het
Krt7	A	T	15: 101,423,426	T375S	probably benign	Het
Krt73	G	A	15: 101,799,909	L238F	probably damaging	Het
Lama5	G	T	2: 180,202,486	H331Q	probably damaging	Het
Leng8	T	G	7: 4,145,136	F663V	probably damaging	Het
Lrp12	G	T	15: 39,878,361	H338Q	probably damaging	Het
Lrp6	T	A	6: 134,468,723	R1042S	probably damaging	Het
Map6	T	A	7: 99,317,457		probably null	Het
Mdn1	T	C	4: 32,700,417	F1459L	possibly damaging	Het
Mmp1b	T	C	9: 7,386,699	T142A	probably damaging	Het
Mmp23	T	A	4: 155,650,709	*392C	probably null	Het
Nlrp4a	C	T	7: 26,450,534	S522F	probably damaging	Het
Nup93	T	G	8: 94,296,555	F254V	probably benign	Het
Oas1h	G	T	5: 120,862,822		probably null	Het
Ocstamp	A	G	2: 165,396,174	L390P	probably damaging	Het
Olfm1	C	A	2: 28,208,116	Y20*	probably null	Het
Olfr1111	A	G	2: 87,150,380	F94L	probably benign	Het
Olfr455	C	T	6: 42,538,603	V140M	probably benign	Het
Olfr541	A	T	7: 140,704,496	K82*	probably null	Het
Olfr608	T	C	7: 103,470,177	V46A	probably benign	Het
Olfr853	A	G	9: 19,537,894	F12S	probably damaging	Het
Pgghg	T	C	7: 140,945,311	V410A	possibly damaging	Het
Polr2b	T	A	5: 77,342,648	D878E	probably benign	Het
Pspc1	T	C	14: 56,764,243	T225A	probably benign	Het
Rad21l	A	T	2: 151,668,527	Y3N	probably damaging	Het
Rbl2	A	G	8: 91,085,724	N280S	probably benign	Het
Rdm1	C	A	11: 101,630,868	Q150K	probably benign	Het
Rrp12	A	T	19: 41,873,749	F932I	probably damaging	Het
Ryr2	A	T	13: 11,731,657	M2003K	probably benign	Het
Scfd2	T	C	5: 74,530,878	T248A	probably benign	Het
Slc22a16	G	A	10: 40,584,927	A242T	possibly damaging	Het
Slit3	C	A	11: 35,675,923	N1007K	probably damaging	Het
Sntg2	C	A	12: 30,267,063	G187C	probably damaging	Het
Spag5	T	C	11: 78,321,326	V1060A	probably damaging	Het
Spg7	G	A	8: 123,090,225	V552I	probably benign	Het
Spns2	T	A	11: 72,456,347	T434S	probably benign	Het
Srpk2	C	T	5: 23,548,494	W87*	probably null	Het
St3gal3	T	C	4: 117,940,392	I268V	possibly damaging	Het
Stat6	T	C	10: 127,653,049	C356R	probably damaging	Het
Stx8	A	G	11: 68,011,422	Q144R	probably damaging	Het
Tcn2	C	A	11: 3,922,169	L319F	probably damaging	Het
Tex14	T	C	11: 87,511,545	I486T	possibly damaging	Het
Thtpa	T	C	14: 55,095,785	V109A	probably benign	Het
Tmem127	C	A	2: 127,248,707	L48I	probably damaging	Het
Tnfaip8	A	T	18: 50,090,223	K9*	probably null	Het
Tnfrsf1b	T	A	4: 145,227,474	T102S	probably benign	Het
Tor1aip1	A	T	1: 156,017,516	M110K	possibly damaging	Het
Trim10	A	T	17: 36,877,181	K430*	probably null	Het
Trove2	T	A	1: 143,757,837	I508F	probably damaging	Het
Trpv6	A	G	6: 41,621,768	V641A	possibly damaging	Het
Ttf1	T	G	2: 29,070,002	Y541D	probably damaging	Het
Ttn	A	G	2: 76,764,406	V20432A	probably damaging	Het
Vac14	A	T	8: 110,632,447		probably null	Het
Vipr2	G	T	12: 116,139,157	A296S	probably benign	Het
Vmn1r1	T	C	1: 182,158,059	R14G	probably benign	Het
Vmn1r178	T	A	7: 23,894,200	N151K	probably damaging	Het
Vmn1r58	T	A	7: 5,410,728	I168F	possibly damaging	Het
Vmn1r77	C	T	7: 12,041,620	Q40*	probably null	Het
Vmn2r76	T	C	7: 86,231,256	N74S	possibly damaging	Het
Zc2hc1c	T	A	12: 85,290,781	M404K	possibly damaging	Het

Other mutations in Abca17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Abca17	APN	17	24295191	missense	probably benign	0.14
IGL00585:Abca17	APN	17	24300320	missense	probably damaging	0.99
IGL00941:Abca17	APN	17	24317130	missense	probably damaging	1.00
IGL01987:Abca17	APN	17	24346228	missense	probably benign	0.00
IGL01988:Abca17	APN	17	24334255	missense	probably damaging	0.99
IGL02223:Abca17	APN	17	24287935	nonsense	probably null
IGL02368:Abca17	APN	17	24287793	missense	probably benign	0.01
IGL02405:Abca17	APN	17	24279062	missense	possibly damaging	0.80
IGL02431:Abca17	APN	17	24298984	missense	probably benign	0.05
IGL02607:Abca17	APN	17	24327705	nonsense	probably null
IGL02706:Abca17	APN	17	24298992	missense	probably benign	0.00
IGL02729:Abca17	APN	17	24280481	missense	probably benign	0.06
IGL02818:Abca17	APN	17	24300352	missense	probably benign	0.02
IGL02891:Abca17	APN	17	24281366	missense	probably damaging	0.99
IGL03236:Abca17	APN	17	24326476	splice site	probably benign
IGL03299:Abca17	APN	17	24265591	missense	probably damaging	1.00
basin	UTSW	17	24318185	missense	probably benign	0.01
Bowl	UTSW	17	24317238	missense	probably benign	0.09
R0018:Abca17	UTSW	17	24313188	splice site	probably null
R0467:Abca17	UTSW	17	24313177	splice site	probably benign
R0671:Abca17	UTSW	17	24281249	missense	probably benign	0.00
R1175:Abca17	UTSW	17	24289351	missense	possibly damaging	0.91
R1397:Abca17	UTSW	17	24285759	missense	probably benign	0.18
R1398:Abca17	UTSW	17	24328537	missense	probably damaging	0.96
R1678:Abca17	UTSW	17	24335620	missense	probably benign	0.05
R1781:Abca17	UTSW	17	24267557	missense	possibly damaging	0.95
R1845:Abca17	UTSW	17	24267716	missense	probably damaging	1.00
R1970:Abca17	UTSW	17	24307575	missense	probably benign	0.00
R1997:Abca17	UTSW	17	24285726	missense	probably benign	0.02
R2141:Abca17	UTSW	17	24334266	missense	probably benign	0.00
R2199:Abca17	UTSW	17	24335624	missense	probably benign	0.19
R2394:Abca17	UTSW	17	24281216	splice site	probably null
R2442:Abca17	UTSW	17	24328632	missense	probably benign	0.02
R2509:Abca17	UTSW	17	24289613	splice site	probably benign
R2848:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2849:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2859:Abca17	UTSW	17	24281314	missense	possibly damaging	0.46
R2879:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2935:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R3153:Abca17	UTSW	17	24328746	missense	probably damaging	1.00
R3154:Abca17	UTSW	17	24328746	missense	probably damaging	1.00
R3434:Abca17	UTSW	17	24289537	missense	probably damaging	1.00
R3695:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R3905:Abca17	UTSW	17	24296283	missense	probably benign	0.13
R4282:Abca17	UTSW	17	24299060	missense	possibly damaging	0.49
R4334:Abca17	UTSW	17	24318268	missense	probably damaging	1.00
R4350:Abca17	UTSW	17	24279046	critical splice donor site	probably null
R4548:Abca17	UTSW	17	24334271	missense	possibly damaging	0.82
R4626:Abca17	UTSW	17	24321084	missense	probably damaging	1.00
R4722:Abca17	UTSW	17	24265429	missense	probably damaging	1.00
R4745:Abca17	UTSW	17	24307453	missense	probably damaging	1.00
R4818:Abca17	UTSW	17	24317161	missense	probably damaging	0.98
R5279:Abca17	UTSW	17	24289414	missense	probably damaging	1.00
R5310:Abca17	UTSW	17	24281230	missense	probably benign	0.00
R5320:Abca17	UTSW	17	24307567	missense	probably damaging	1.00
R5435:Abca17	UTSW	17	24267614	missense	possibly damaging	0.90
R5622:Abca17	UTSW	17	24327668	missense	probably benign	0.14
R5776:Abca17	UTSW	17	24295158	missense	probably benign	0.09
R5928:Abca17	UTSW	17	24318185	missense	probably benign	0.01
R6013:Abca17	UTSW	17	24287846	missense	possibly damaging	0.79
R6035:Abca17	UTSW	17	24281245	missense	possibly damaging	0.79
R6035:Abca17	UTSW	17	24281245	missense	possibly damaging	0.79
R6052:Abca17	UTSW	17	24318191	missense	probably benign	0.00
R6063:Abca17	UTSW	17	24264344	missense	unknown
R6404:Abca17	UTSW	17	24265918	missense	probably benign	0.13
R6746:Abca17	UTSW	17	24346221	nonsense	probably null
R6819:Abca17	UTSW	17	24287793	missense	probably benign	0.01
R6828:Abca17	UTSW	17	24326415	missense	possibly damaging	0.91
R7043:Abca17	UTSW	17	24265500	missense	probably damaging	1.00
R7065:Abca17	UTSW	17	24327751	missense	probably damaging	1.00
R7123:Abca17	UTSW	17	24265975	missense	probably damaging	1.00
R7157:Abca17	UTSW	17	24335590	missense	possibly damaging	0.46
R7188:Abca17	UTSW	17	24335626	missense	possibly damaging	0.89
R7294:Abca17	UTSW	17	24321009	missense	not run
R7352:Abca17	UTSW	17	24289054	nonsense	probably null
R7355:Abca17	UTSW	17	24267647	missense	probably benign	0.00
R7358:Abca17	UTSW	17	24291555	missense	probably benign	0.00
R7411:Abca17	UTSW	17	24328569	missense	possibly damaging	0.52
R7915:Abca17	UTSW	17	24265533	missense	probably damaging	1.00
R8039:Abca17	UTSW	17	24328725	missense	probably damaging	1.00
R8095:Abca17	UTSW	17	24317222	missense	possibly damaging	0.77
R8308:Abca17	UTSW	17	24267683	missense	probably damaging	1.00
R8517:Abca17	UTSW	17	24317233	missense	probably benign	0.00
R8811:Abca17	UTSW	17	24317238	missense	probably benign	0.09
R8819:Abca17	UTSW	17	24328602	missense	probably damaging	1.00
R8820:Abca17	UTSW	17	24328602	missense	probably damaging	1.00
R8953:Abca17	UTSW	17	24299041	missense	probably benign
R9095:Abca17	UTSW	17	24281396	missense	probably damaging	0.97
R9313:Abca17	UTSW	17	24346233	missense	probably benign	0.00
R9314:Abca17	UTSW	17	24328619	missense	possibly damaging	0.91
R9347:Abca17	UTSW	17	24264505	missense	probably benign
R9351:Abca17	UTSW	17	24291777	missense	probably benign	0.00
R9387:Abca17	UTSW	17	24334281	missense	probably benign	0.02
R9388:Abca17	UTSW	17	24264299	missense	unknown
R9440:Abca17	UTSW	17	24280478	missense	probably benign	0.02
R9498:Abca17	UTSW	17	24265506	missense	probably damaging	1.00
R9654:Abca17	UTSW	17	24317125	missense	probably benign	0.09
R9709:Abca17	UTSW	17	24298960	missense	probably benign
R9770:Abca17	UTSW	17	24295147	missense	probably benign	0.00
R9773:Abca17	UTSW	17	24289591	missense	probably damaging	1.00
RF024:Abca17	UTSW	17	24287732	frame shift	probably null
RF029:Abca17	UTSW	17	24287727	critical splice donor site	probably benign
RF032:Abca17	UTSW	17	24287727	frame shift	probably null
RF036:Abca17	UTSW	17	24287727	critical splice donor site	probably benign
X0017:Abca17	UTSW	17	24317163	missense	probably benign	0.26
X0065:Abca17	UTSW	17	24334284	missense	probably damaging	1.00
Z1088:Abca17	UTSW	17	24279079	missense	probably damaging	0.96
Z1088:Abca17	UTSW	17	24279107	missense	probably benign	0.03
Z1088:Abca17	UTSW	17	24346219	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGCACAGCTCTTCTATGCCTGAC -3'
(R):5'- ACACATGGCTCCTTCATGCTGC -3'

Sequencing Primer
(F):5'- TGACAGGCTTTACTCTACAATCCAG -3'
(R):5'- CTGCATGAGTGTCCCTATAGTAGAC -3'

Posted On

2014-05-14