Incidental Mutation 'R1697:Acsl3'
ID 192299
Institutional Source Beutler Lab
Gene Symbol Acsl3
Ensembl Gene ENSMUSG00000032883
Gene Name acyl-CoA synthetase long-chain family member 3
Synonyms C85929, 2610510B12Rik, Facl3
MMRRC Submission 039730-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.544) question?
Stock # R1697 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 78635600-78685462 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 78683114 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035779] [ENSMUST00000134566] [ENSMUST00000142704]
AlphaFold Q9CZW4
Predicted Effect probably benign
Transcript: ENSMUST00000035779
SMART Domains Protein: ENSMUSP00000045291
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134566
SMART Domains Protein: ENSMUSP00000117952
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
Pfam:AMP-binding 1 435 4.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142704
SMART Domains Protein: ENSMUSP00000121695
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2.5e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148608
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in brain, and preferentially utilizes myristate, arachidonate, and eicosapentaenoate as substrates. The amino acid sequence of this isozyme is 92% identical to that of rat homolog. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit decreased blood percentages of CD4 T cells and B cells, and a decreased IgG1 response to ovalbumin. Male mutant mice exhibit growth retardation, reduced size and reduced total tissue and lean body mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,992,928 (GRCm39) D250E probably damaging Het
4930571K23Rik A G 7: 124,968,201 (GRCm39) noncoding transcript Het
Acsl6 C A 11: 54,220,792 (GRCm39) T244K probably damaging Het
Adam26b T A 8: 43,974,000 (GRCm39) N334I probably damaging Het
Adgrl4 C T 3: 151,223,248 (GRCm39) T608M probably damaging Het
Aldh2 A G 5: 121,716,404 (GRCm39) probably null Het
Alms1 A G 6: 85,599,436 (GRCm39) T1890A possibly damaging Het
Capn7 C T 14: 31,082,117 (GRCm39) T441M probably damaging Het
Cd9 A T 6: 125,441,367 (GRCm39) C85S probably damaging Het
Chrm3 T C 13: 9,928,794 (GRCm39) T81A probably damaging Het
Ctif A G 18: 75,757,376 (GRCm39) probably benign Het
Dcc T A 18: 71,503,808 (GRCm39) D950V probably damaging Het
Eif4g1 T C 16: 20,498,530 (GRCm39) V422A probably damaging Het
Enthd1 A G 15: 80,337,124 (GRCm39) S437P probably damaging Het
Fads1 A G 19: 10,171,464 (GRCm39) probably benign Het
Fat3 T A 9: 15,856,176 (GRCm39) I3869L probably benign Het
Fbxw5 T A 2: 25,392,473 (GRCm39) V85E possibly damaging Het
Fcgbpl1 T A 7: 27,853,772 (GRCm39) C1579S probably damaging Het
Fem1b T C 9: 62,704,456 (GRCm39) D268G possibly damaging Het
Focad T C 4: 88,327,225 (GRCm39) L1772P probably damaging Het
Gtf3a C A 5: 146,888,723 (GRCm39) Q145K possibly damaging Het
Hacl1 T C 14: 31,342,957 (GRCm39) probably null Het
Herc2 T A 7: 55,803,653 (GRCm39) F2229L probably benign Het
Hs3st4 A T 7: 123,996,080 (GRCm39) I249L probably benign Het
Iqsec1 A T 6: 90,786,752 (GRCm39) Y7* probably null Het
Irag2 A G 6: 145,083,341 (GRCm39) probably benign Het
Klk1b1 T A 7: 43,619,750 (GRCm39) M103K probably benign Het
Krt5 A G 15: 101,619,020 (GRCm39) V287A probably benign Het
Lgals12 T A 19: 7,581,530 (GRCm39) Q59L possibly damaging Het
Loxl4 A G 19: 42,593,379 (GRCm39) V264A possibly damaging Het
Lrp1b T C 2: 40,712,695 (GRCm39) D3099G probably damaging Het
Mical3 G A 6: 120,984,369 (GRCm39) T169I possibly damaging Het
Muc21 A C 17: 35,931,540 (GRCm39) probably benign Het
Myef2l G A 3: 10,154,613 (GRCm39) V461I possibly damaging Het
Myh7b A C 2: 155,462,054 (GRCm39) S317R probably damaging Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Nsd1 A T 13: 55,361,872 (GRCm39) probably null Het
Nup58 A T 14: 60,482,119 (GRCm39) probably benign Het
Or1j17 C T 2: 36,578,259 (GRCm39) L82F probably damaging Het
Or2t49 A T 11: 58,392,502 (GRCm39) S293R probably damaging Het
Or5h22 A G 16: 58,895,270 (GRCm39) Y58H probably damaging Het
Or5i1 T A 2: 87,612,929 (GRCm39) I15N possibly damaging Het
Or6c2b T C 10: 128,947,737 (GRCm39) T186A probably benign Het
Pcnx2 A G 8: 126,577,087 (GRCm39) Y982H probably damaging Het
Pias3 T C 3: 96,609,541 (GRCm39) L312P probably damaging Het
Plekhm1 G A 11: 103,267,710 (GRCm39) P754S probably damaging Het
Ppp2r5c T A 12: 110,512,057 (GRCm39) L145* probably null Het
Ppp2r5c T A 12: 110,527,906 (GRCm39) probably benign Het
Pramel29 A C 4: 143,935,162 (GRCm39) I193S probably damaging Het
Proser3 T C 7: 30,239,446 (GRCm39) M553V probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Smurf2 A T 11: 106,715,514 (GRCm39) D664E possibly damaging Het
Spag9 G A 11: 93,887,391 (GRCm39) A99T probably benign Het
Stim1 T G 7: 102,003,713 (GRCm39) C49G probably damaging Het
Stk32c T C 7: 138,701,740 (GRCm39) I238V probably benign Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Tfb2m T A 1: 179,372,464 (GRCm39) E133V probably null Het
Tmem209 A T 6: 30,497,867 (GRCm39) C143S probably benign Het
Tnr T G 1: 159,679,600 (GRCm39) N191K probably benign Het
Vars1 C T 17: 35,217,198 (GRCm39) A419T probably benign Het
Vmn2r111 T C 17: 22,767,041 (GRCm39) S819G probably benign Het
Wls T C 3: 159,602,995 (GRCm39) V136A probably benign Het
Ybx2 C T 11: 69,830,887 (GRCm39) S217L probably benign Het
Zfp82 T C 7: 29,756,779 (GRCm39) D37G probably benign Het
Other mutations in Acsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Acsl3 APN 1 78,677,476 (GRCm39) missense possibly damaging 0.79
IGL02201:Acsl3 APN 1 78,676,870 (GRCm39) missense probably damaging 1.00
IGL03162:Acsl3 APN 1 78,676,887 (GRCm39) critical splice donor site probably null
R0601:Acsl3 UTSW 1 78,673,896 (GRCm39) missense probably damaging 1.00
R0658:Acsl3 UTSW 1 78,679,004 (GRCm39) missense probably damaging 1.00
R1389:Acsl3 UTSW 1 78,665,999 (GRCm39) missense probably benign
R1468:Acsl3 UTSW 1 78,684,126 (GRCm39) missense probably benign 0.03
R1468:Acsl3 UTSW 1 78,684,126 (GRCm39) missense probably benign 0.03
R2083:Acsl3 UTSW 1 78,677,528 (GRCm39) missense probably damaging 0.99
R2125:Acsl3 UTSW 1 78,659,678 (GRCm39) missense probably damaging 0.97
R2191:Acsl3 UTSW 1 78,676,857 (GRCm39) missense probably damaging 1.00
R2299:Acsl3 UTSW 1 78,676,827 (GRCm39) missense probably damaging 1.00
R2395:Acsl3 UTSW 1 78,683,085 (GRCm39) missense probably benign 0.00
R2964:Acsl3 UTSW 1 78,672,011 (GRCm39) missense probably benign 0.01
R3403:Acsl3 UTSW 1 78,673,839 (GRCm39) missense probably damaging 1.00
R4655:Acsl3 UTSW 1 78,668,063 (GRCm39) missense probably damaging 1.00
R5537:Acsl3 UTSW 1 78,684,073 (GRCm39) missense probably damaging 1.00
R5823:Acsl3 UTSW 1 78,666,003 (GRCm39) missense probably benign
R6239:Acsl3 UTSW 1 78,674,182 (GRCm39) missense probably benign 0.00
R6376:Acsl3 UTSW 1 78,674,182 (GRCm39) missense possibly damaging 0.81
R6650:Acsl3 UTSW 1 78,659,639 (GRCm39) missense probably benign 0.03
R7031:Acsl3 UTSW 1 78,666,000 (GRCm39) missense probably benign
R7282:Acsl3 UTSW 1 78,659,709 (GRCm39) missense probably damaging 0.97
R7733:Acsl3 UTSW 1 78,665,953 (GRCm39) critical splice acceptor site probably null
R7891:Acsl3 UTSW 1 78,681,305 (GRCm39) missense probably benign 0.02
R7998:Acsl3 UTSW 1 78,671,988 (GRCm39) missense probably damaging 1.00
R8056:Acsl3 UTSW 1 78,659,611 (GRCm39) missense probably damaging 1.00
R8083:Acsl3 UTSW 1 78,669,844 (GRCm39) missense probably damaging 1.00
R8084:Acsl3 UTSW 1 78,669,844 (GRCm39) missense probably damaging 1.00
R8135:Acsl3 UTSW 1 78,674,712 (GRCm39) missense probably benign 0.00
R8982:Acsl3 UTSW 1 78,677,485 (GRCm39) missense probably benign 0.00
R9267:Acsl3 UTSW 1 78,674,623 (GRCm39) missense probably damaging 1.00
R9380:Acsl3 UTSW 1 78,659,602 (GRCm39) missense possibly damaging 0.47
X0025:Acsl3 UTSW 1 78,669,919 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTAAGACGATTAGTAAGCGCAGTACG -3'
(R):5'- ATAGACTCACTGGGCCAGGACACA -3'

Sequencing Primer
(F):5'- AACTTTGGTCCTTGACTAAGTTATCC -3'
(R):5'- caggagacaggaaaaataactaagac -3'
Posted On 2014-05-14