Incidental Mutation 'R1697:Fbxw5'
ID 192302
Institutional Source Beutler Lab
Gene Symbol Fbxw5
Ensembl Gene ENSMUSG00000015095
Gene Name F-box and WD-40 domain protein 5
Synonyms Fbw5
MMRRC Submission 039730-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.416) question?
Stock # R1697 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 25390762-25395482 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25392473 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 85 (V85E)
Ref Sequence ENSEMBL: ENSMUSP00000015239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015227] [ENSMUST00000015239] [ENSMUST00000040042] [ENSMUST00000124375]
AlphaFold Q9QXW2
Predicted Effect probably benign
Transcript: ENSMUST00000015227
SMART Domains Protein: ENSMUSP00000015227
Gene: ENSMUSG00000015083

DomainStartEndE-ValueType
Pfam:Lipocalin 14 152 3.3e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000015239
AA Change: V85E

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000015239
Gene: ENSMUSG00000015095
AA Change: V85E

DomainStartEndE-ValueType
FBOX 9 49 7.7e-6 SMART
WD40 81 120 3.11e-10 SMART
WD40 456 500 1.98e1 SMART
WD40 503 542 6.28e-6 SMART
low complexity region 553 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040042
SMART Domains Protein: ENSMUSP00000041855
Gene: ENSMUSG00000015083

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Lipocalin 48 186 3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124258
Predicted Effect probably benign
Transcript: ENSMUST00000124375
SMART Domains Protein: ENSMUSP00000117676
Gene: ENSMUSG00000015095

DomainStartEndE-ValueType
SCOP:d1jjub_ 116 246 1e-11 SMART
Blast:WD40 172 216 2e-25 BLAST
Blast:WD40 219 246 7e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153139
Meta Mutation Damage Score 0.5839 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene contains WD-40 domains, in addition to an F-box motif, so it belongs to the Fbw class. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene, however, they were found to be nonsense-mediated mRNA decay (NMD) candidates, hence not represented. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,992,928 (GRCm39) D250E probably damaging Het
4930571K23Rik A G 7: 124,968,201 (GRCm39) noncoding transcript Het
Acsl3 T C 1: 78,683,114 (GRCm39) probably benign Het
Acsl6 C A 11: 54,220,792 (GRCm39) T244K probably damaging Het
Adam26b T A 8: 43,974,000 (GRCm39) N334I probably damaging Het
Adgrl4 C T 3: 151,223,248 (GRCm39) T608M probably damaging Het
Aldh2 A G 5: 121,716,404 (GRCm39) probably null Het
Alms1 A G 6: 85,599,436 (GRCm39) T1890A possibly damaging Het
Capn7 C T 14: 31,082,117 (GRCm39) T441M probably damaging Het
Cd9 A T 6: 125,441,367 (GRCm39) C85S probably damaging Het
Chrm3 T C 13: 9,928,794 (GRCm39) T81A probably damaging Het
Ctif A G 18: 75,757,376 (GRCm39) probably benign Het
Dcc T A 18: 71,503,808 (GRCm39) D950V probably damaging Het
Eif4g1 T C 16: 20,498,530 (GRCm39) V422A probably damaging Het
Enthd1 A G 15: 80,337,124 (GRCm39) S437P probably damaging Het
Fads1 A G 19: 10,171,464 (GRCm39) probably benign Het
Fat3 T A 9: 15,856,176 (GRCm39) I3869L probably benign Het
Fcgbpl1 T A 7: 27,853,772 (GRCm39) C1579S probably damaging Het
Fem1b T C 9: 62,704,456 (GRCm39) D268G possibly damaging Het
Focad T C 4: 88,327,225 (GRCm39) L1772P probably damaging Het
Gtf3a C A 5: 146,888,723 (GRCm39) Q145K possibly damaging Het
Hacl1 T C 14: 31,342,957 (GRCm39) probably null Het
Herc2 T A 7: 55,803,653 (GRCm39) F2229L probably benign Het
Hs3st4 A T 7: 123,996,080 (GRCm39) I249L probably benign Het
Iqsec1 A T 6: 90,786,752 (GRCm39) Y7* probably null Het
Irag2 A G 6: 145,083,341 (GRCm39) probably benign Het
Klk1b1 T A 7: 43,619,750 (GRCm39) M103K probably benign Het
Krt5 A G 15: 101,619,020 (GRCm39) V287A probably benign Het
Lgals12 T A 19: 7,581,530 (GRCm39) Q59L possibly damaging Het
Loxl4 A G 19: 42,593,379 (GRCm39) V264A possibly damaging Het
Lrp1b T C 2: 40,712,695 (GRCm39) D3099G probably damaging Het
Mical3 G A 6: 120,984,369 (GRCm39) T169I possibly damaging Het
Muc21 A C 17: 35,931,540 (GRCm39) probably benign Het
Myef2l G A 3: 10,154,613 (GRCm39) V461I possibly damaging Het
Myh7b A C 2: 155,462,054 (GRCm39) S317R probably damaging Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Nsd1 A T 13: 55,361,872 (GRCm39) probably null Het
Nup58 A T 14: 60,482,119 (GRCm39) probably benign Het
Or1j17 C T 2: 36,578,259 (GRCm39) L82F probably damaging Het
Or2t49 A T 11: 58,392,502 (GRCm39) S293R probably damaging Het
Or5h22 A G 16: 58,895,270 (GRCm39) Y58H probably damaging Het
Or5i1 T A 2: 87,612,929 (GRCm39) I15N possibly damaging Het
Or6c2b T C 10: 128,947,737 (GRCm39) T186A probably benign Het
Pcnx2 A G 8: 126,577,087 (GRCm39) Y982H probably damaging Het
Pias3 T C 3: 96,609,541 (GRCm39) L312P probably damaging Het
Plekhm1 G A 11: 103,267,710 (GRCm39) P754S probably damaging Het
Ppp2r5c T A 12: 110,512,057 (GRCm39) L145* probably null Het
Ppp2r5c T A 12: 110,527,906 (GRCm39) probably benign Het
Pramel29 A C 4: 143,935,162 (GRCm39) I193S probably damaging Het
Proser3 T C 7: 30,239,446 (GRCm39) M553V probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Smurf2 A T 11: 106,715,514 (GRCm39) D664E possibly damaging Het
Spag9 G A 11: 93,887,391 (GRCm39) A99T probably benign Het
Stim1 T G 7: 102,003,713 (GRCm39) C49G probably damaging Het
Stk32c T C 7: 138,701,740 (GRCm39) I238V probably benign Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Tfb2m T A 1: 179,372,464 (GRCm39) E133V probably null Het
Tmem209 A T 6: 30,497,867 (GRCm39) C143S probably benign Het
Tnr T G 1: 159,679,600 (GRCm39) N191K probably benign Het
Vars1 C T 17: 35,217,198 (GRCm39) A419T probably benign Het
Vmn2r111 T C 17: 22,767,041 (GRCm39) S819G probably benign Het
Wls T C 3: 159,602,995 (GRCm39) V136A probably benign Het
Ybx2 C T 11: 69,830,887 (GRCm39) S217L probably benign Het
Zfp82 T C 7: 29,756,779 (GRCm39) D37G probably benign Het
Other mutations in Fbxw5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02053:Fbxw5 APN 2 25,393,453 (GRCm39) missense probably damaging 0.99
IGL02162:Fbxw5 APN 2 25,393,283 (GRCm39) missense probably damaging 0.96
IGL02261:Fbxw5 APN 2 25,393,746 (GRCm39) missense probably benign 0.01
IGL02298:Fbxw5 APN 2 25,394,456 (GRCm39) nonsense probably null
IGL02822:Fbxw5 APN 2 25,393,022 (GRCm39) missense probably benign 0.06
R0416:Fbxw5 UTSW 2 25,393,251 (GRCm39) missense probably damaging 1.00
R0423:Fbxw5 UTSW 2 25,394,538 (GRCm39) missense possibly damaging 0.90
R0616:Fbxw5 UTSW 2 25,392,517 (GRCm39) missense probably damaging 1.00
R0730:Fbxw5 UTSW 2 25,394,630 (GRCm39) missense possibly damaging 0.49
R1660:Fbxw5 UTSW 2 25,393,286 (GRCm39) critical splice donor site probably null
R1737:Fbxw5 UTSW 2 25,393,596 (GRCm39) missense probably benign 0.01
R2030:Fbxw5 UTSW 2 25,394,810 (GRCm39) missense probably damaging 1.00
R2274:Fbxw5 UTSW 2 25,394,773 (GRCm39) nonsense probably null
R2406:Fbxw5 UTSW 2 25,394,195 (GRCm39) missense probably damaging 1.00
R3815:Fbxw5 UTSW 2 25,393,576 (GRCm39) missense possibly damaging 0.62
R4082:Fbxw5 UTSW 2 25,394,643 (GRCm39) critical splice donor site probably null
R4249:Fbxw5 UTSW 2 25,393,472 (GRCm39) missense probably damaging 0.98
R6170:Fbxw5 UTSW 2 25,393,615 (GRCm39) missense possibly damaging 0.96
R6502:Fbxw5 UTSW 2 25,392,448 (GRCm39) missense possibly damaging 0.68
R7826:Fbxw5 UTSW 2 25,392,561 (GRCm39) nonsense probably null
R9658:Fbxw5 UTSW 2 25,393,870 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTCCCAGTAGCCATGCTGTC -3'
(R):5'- TCGTACCAATGTAGAGGGCTGACC -3'

Sequencing Primer
(F):5'- AGCCATGCTGTCTGTCG -3'
(R):5'- TGACCCTGGGAGCTAGAGATTAG -3'
Posted On 2014-05-14