Incidental Mutation 'R1697:Or1j17'
ID 192303
Institutional Source Beutler Lab
Gene Symbol Or1j17
Ensembl Gene ENSMUSG00000094764
Gene Name olfactory receptor family 1 subfamily J member 17
Synonyms GA_x6K02T2NLDC-33382467-33383396, Olfr346, MOR136-11
MMRRC Submission 039730-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R1697 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 36578016-36578945 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 36578259 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 82 (L82F)
Ref Sequence ENSEMBL: ENSMUSP00000149916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078854] [ENSMUST00000213258]
AlphaFold Q8VGJ7
Predicted Effect probably damaging
Transcript: ENSMUST00000078854
AA Change: L82F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077897
Gene: ENSMUSG00000094764
AA Change: L82F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.2e-58 PFAM
Pfam:7tm_1 41 290 1.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213258
AA Change: L82F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,992,928 (GRCm39) D250E probably damaging Het
4930571K23Rik A G 7: 124,968,201 (GRCm39) noncoding transcript Het
Acsl3 T C 1: 78,683,114 (GRCm39) probably benign Het
Acsl6 C A 11: 54,220,792 (GRCm39) T244K probably damaging Het
Adam26b T A 8: 43,974,000 (GRCm39) N334I probably damaging Het
Adgrl4 C T 3: 151,223,248 (GRCm39) T608M probably damaging Het
Aldh2 A G 5: 121,716,404 (GRCm39) probably null Het
Alms1 A G 6: 85,599,436 (GRCm39) T1890A possibly damaging Het
Capn7 C T 14: 31,082,117 (GRCm39) T441M probably damaging Het
Cd9 A T 6: 125,441,367 (GRCm39) C85S probably damaging Het
Chrm3 T C 13: 9,928,794 (GRCm39) T81A probably damaging Het
Ctif A G 18: 75,757,376 (GRCm39) probably benign Het
Dcc T A 18: 71,503,808 (GRCm39) D950V probably damaging Het
Eif4g1 T C 16: 20,498,530 (GRCm39) V422A probably damaging Het
Enthd1 A G 15: 80,337,124 (GRCm39) S437P probably damaging Het
Fads1 A G 19: 10,171,464 (GRCm39) probably benign Het
Fat3 T A 9: 15,856,176 (GRCm39) I3869L probably benign Het
Fbxw5 T A 2: 25,392,473 (GRCm39) V85E possibly damaging Het
Fcgbpl1 T A 7: 27,853,772 (GRCm39) C1579S probably damaging Het
Fem1b T C 9: 62,704,456 (GRCm39) D268G possibly damaging Het
Focad T C 4: 88,327,225 (GRCm39) L1772P probably damaging Het
Gtf3a C A 5: 146,888,723 (GRCm39) Q145K possibly damaging Het
Hacl1 T C 14: 31,342,957 (GRCm39) probably null Het
Herc2 T A 7: 55,803,653 (GRCm39) F2229L probably benign Het
Hs3st4 A T 7: 123,996,080 (GRCm39) I249L probably benign Het
Iqsec1 A T 6: 90,786,752 (GRCm39) Y7* probably null Het
Irag2 A G 6: 145,083,341 (GRCm39) probably benign Het
Klk1b1 T A 7: 43,619,750 (GRCm39) M103K probably benign Het
Krt5 A G 15: 101,619,020 (GRCm39) V287A probably benign Het
Lgals12 T A 19: 7,581,530 (GRCm39) Q59L possibly damaging Het
Loxl4 A G 19: 42,593,379 (GRCm39) V264A possibly damaging Het
Lrp1b T C 2: 40,712,695 (GRCm39) D3099G probably damaging Het
Mical3 G A 6: 120,984,369 (GRCm39) T169I possibly damaging Het
Muc21 A C 17: 35,931,540 (GRCm39) probably benign Het
Myef2l G A 3: 10,154,613 (GRCm39) V461I possibly damaging Het
Myh7b A C 2: 155,462,054 (GRCm39) S317R probably damaging Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Nsd1 A T 13: 55,361,872 (GRCm39) probably null Het
Nup58 A T 14: 60,482,119 (GRCm39) probably benign Het
Or2t49 A T 11: 58,392,502 (GRCm39) S293R probably damaging Het
Or5h22 A G 16: 58,895,270 (GRCm39) Y58H probably damaging Het
Or5i1 T A 2: 87,612,929 (GRCm39) I15N possibly damaging Het
Or6c2b T C 10: 128,947,737 (GRCm39) T186A probably benign Het
Pcnx2 A G 8: 126,577,087 (GRCm39) Y982H probably damaging Het
Pias3 T C 3: 96,609,541 (GRCm39) L312P probably damaging Het
Plekhm1 G A 11: 103,267,710 (GRCm39) P754S probably damaging Het
Ppp2r5c T A 12: 110,512,057 (GRCm39) L145* probably null Het
Ppp2r5c T A 12: 110,527,906 (GRCm39) probably benign Het
Pramel29 A C 4: 143,935,162 (GRCm39) I193S probably damaging Het
Proser3 T C 7: 30,239,446 (GRCm39) M553V probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Smurf2 A T 11: 106,715,514 (GRCm39) D664E possibly damaging Het
Spag9 G A 11: 93,887,391 (GRCm39) A99T probably benign Het
Stim1 T G 7: 102,003,713 (GRCm39) C49G probably damaging Het
Stk32c T C 7: 138,701,740 (GRCm39) I238V probably benign Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Tfb2m T A 1: 179,372,464 (GRCm39) E133V probably null Het
Tmem209 A T 6: 30,497,867 (GRCm39) C143S probably benign Het
Tnr T G 1: 159,679,600 (GRCm39) N191K probably benign Het
Vars1 C T 17: 35,217,198 (GRCm39) A419T probably benign Het
Vmn2r111 T C 17: 22,767,041 (GRCm39) S819G probably benign Het
Wls T C 3: 159,602,995 (GRCm39) V136A probably benign Het
Ybx2 C T 11: 69,830,887 (GRCm39) S217L probably benign Het
Zfp82 T C 7: 29,756,779 (GRCm39) D37G probably benign Het
Other mutations in Or1j17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Or1j17 APN 2 36,578,550 (GRCm39) missense probably damaging 1.00
IGL01770:Or1j17 APN 2 36,578,117 (GRCm39) missense probably benign 0.02
IGL02110:Or1j17 APN 2 36,578,697 (GRCm39) missense probably benign
IGL02212:Or1j17 APN 2 36,578,194 (GRCm39) missense probably damaging 0.98
IGL02346:Or1j17 APN 2 36,578,016 (GRCm39) start codon destroyed probably benign 0.41
IGL02544:Or1j17 APN 2 36,578,848 (GRCm39) missense probably damaging 1.00
IGL02995:Or1j17 APN 2 36,578,644 (GRCm39) missense possibly damaging 0.56
IGL03154:Or1j17 APN 2 36,578,655 (GRCm39) missense possibly damaging 0.78
IGL03389:Or1j17 APN 2 36,578,274 (GRCm39) missense probably benign 0.12
R0100:Or1j17 UTSW 2 36,578,923 (GRCm39) missense probably benign 0.00
R0230:Or1j17 UTSW 2 36,578,628 (GRCm39) missense probably benign 0.01
R1559:Or1j17 UTSW 2 36,578,770 (GRCm39) missense probably damaging 1.00
R1560:Or1j17 UTSW 2 36,578,155 (GRCm39) missense probably damaging 1.00
R1614:Or1j17 UTSW 2 36,578,321 (GRCm39) nonsense probably null
R1738:Or1j17 UTSW 2 36,578,797 (GRCm39) missense probably benign 0.44
R1966:Or1j17 UTSW 2 36,578,796 (GRCm39) missense probably benign 0.01
R2021:Or1j17 UTSW 2 36,578,487 (GRCm39) missense probably benign
R2181:Or1j17 UTSW 2 36,578,346 (GRCm39) missense probably damaging 1.00
R4170:Or1j17 UTSW 2 36,578,734 (GRCm39) missense probably damaging 0.98
R4625:Or1j17 UTSW 2 36,578,083 (GRCm39) missense probably benign 0.06
R5081:Or1j17 UTSW 2 36,578,655 (GRCm39) missense possibly damaging 0.73
R5335:Or1j17 UTSW 2 36,578,106 (GRCm39) missense probably benign
R5966:Or1j17 UTSW 2 36,578,074 (GRCm39) missense probably null 0.00
R5978:Or1j17 UTSW 2 36,578,694 (GRCm39) missense probably benign 0.07
R6110:Or1j17 UTSW 2 36,578,559 (GRCm39) missense probably benign 0.01
R6329:Or1j17 UTSW 2 36,578,694 (GRCm39) nonsense probably null
R7214:Or1j17 UTSW 2 36,578,107 (GRCm39) missense probably benign 0.35
R7301:Or1j17 UTSW 2 36,578,023 (GRCm39) missense probably benign
R7382:Or1j17 UTSW 2 36,578,046 (GRCm39) nonsense probably null
R7979:Or1j17 UTSW 2 36,578,106 (GRCm39) missense probably benign 0.03
R8218:Or1j17 UTSW 2 36,578,685 (GRCm39) missense probably benign 0.12
R8501:Or1j17 UTSW 2 36,578,809 (GRCm39) missense probably benign 0.00
R9406:Or1j17 UTSW 2 36,578,296 (GRCm39) missense possibly damaging 0.93
R9623:Or1j17 UTSW 2 36,578,778 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AAGCTGTGTACTCTGCCCTGATCC -3'
(R):5'- TCAGAATGGTGACACCAATGTAGCC -3'

Sequencing Primer
(F):5'- GCTCATCATCCTGCTCATCA -3'
(R):5'- TGGTGACACCAATGTAGCCATAAG -3'
Posted On 2014-05-14