Incidental Mutation 'R1697:Olfr346'
ID192303
Institutional Source Beutler Lab
Gene Symbol Olfr346
Ensembl Gene ENSMUSG00000094764
Gene Nameolfactory receptor 346
SynonymsMOR136-11, GA_x6K02T2NLDC-33382467-33383396
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1697 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36685788-36691293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36688247 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 82 (L82F)
Ref Sequence ENSEMBL: ENSMUSP00000149916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078854] [ENSMUST00000213258]
Predicted Effect probably damaging
Transcript: ENSMUST00000078854
AA Change: L82F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077897
Gene: ENSMUSG00000094764
AA Change: L82F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.2e-58 PFAM
Pfam:7tm_1 41 290 1.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213258
AA Change: L82F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Olfr346
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Olfr346 APN 2 36688538 missense probably damaging 1.00
IGL01770:Olfr346 APN 2 36688105 missense probably benign 0.02
IGL02110:Olfr346 APN 2 36688685 missense probably benign
IGL02212:Olfr346 APN 2 36688182 missense probably damaging 0.98
IGL02346:Olfr346 APN 2 36688004 start codon destroyed probably benign 0.41
IGL02544:Olfr346 APN 2 36688836 missense probably damaging 1.00
IGL02995:Olfr346 APN 2 36688632 missense possibly damaging 0.56
IGL03154:Olfr346 APN 2 36688643 missense possibly damaging 0.78
IGL03389:Olfr346 APN 2 36688262 missense probably benign 0.12
R0100:Olfr346 UTSW 2 36688911 missense probably benign 0.00
R0230:Olfr346 UTSW 2 36688616 missense probably benign 0.01
R1559:Olfr346 UTSW 2 36688758 missense probably damaging 1.00
R1560:Olfr346 UTSW 2 36688143 missense probably damaging 1.00
R1614:Olfr346 UTSW 2 36688309 nonsense probably null
R1738:Olfr346 UTSW 2 36688785 missense probably benign 0.44
R1966:Olfr346 UTSW 2 36688784 missense probably benign 0.01
R2021:Olfr346 UTSW 2 36688475 missense probably benign
R2181:Olfr346 UTSW 2 36688334 missense probably damaging 1.00
R4170:Olfr346 UTSW 2 36688722 missense probably damaging 0.98
R4625:Olfr346 UTSW 2 36688071 missense probably benign 0.06
R5081:Olfr346 UTSW 2 36688643 missense possibly damaging 0.73
R5335:Olfr346 UTSW 2 36688094 missense probably benign
R5966:Olfr346 UTSW 2 36688062 missense probably null 0.00
R5978:Olfr346 UTSW 2 36688682 missense probably benign 0.07
R6110:Olfr346 UTSW 2 36688547 missense probably benign 0.01
R6329:Olfr346 UTSW 2 36688682 nonsense probably null
R7214:Olfr346 UTSW 2 36688095 missense probably benign 0.35
R7301:Olfr346 UTSW 2 36688011 missense probably benign
R7382:Olfr346 UTSW 2 36688034 nonsense probably null
R7979:Olfr346 UTSW 2 36688094 missense probably benign 0.03
R8218:Olfr346 UTSW 2 36688673 missense probably benign 0.12
R8501:Olfr346 UTSW 2 36688797 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCTGTGTACTCTGCCCTGATCC -3'
(R):5'- TCAGAATGGTGACACCAATGTAGCC -3'

Sequencing Primer
(F):5'- GCTCATCATCCTGCTCATCA -3'
(R):5'- TGGTGACACCAATGTAGCCATAAG -3'
Posted On2014-05-14