Mutagenetix > Incidental Mutations

Incidental Mutation 'R1697:Pias3'

192309

Institutional Source

Beutler Lab

Gene Symbol

Pias3

Ensembl Gene

ENSMUSG00000028101

Gene Name

protein inhibitor of activated STAT 3

Synonyms

Pias3L

MMRRC Submission

039730-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.639) question?

Stock #

R1697 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96696384-96706070 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 96702225 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 312 (L312P)

Ref Sequence

ENSEMBL: ENSMUSP00000125747 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029742] [ENSMUST00000064900] [ENSMUST00000107076] [ENSMUST00000107077] [ENSMUST00000162778] [ENSMUST00000162934] [ENSMUST00000171249] [ENSMUST00000176302] [ENSMUST00000200387]

AlphaFold

O54714

Predicted Effect

probably benign
Transcript: ENSMUST00000029742

SMART Domains

Protein: ENSMUSP00000029742
Gene: ENSMUSG00000028100

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
Pfam:NUDIX	92	252	2.2e-9	PFAM
low complexity region	273	288	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000064900
AA Change: L321P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000069259
Gene: ENSMUSG00000028101
AA Change: L321P

Domain	Start	End	E-Value	Type
SAP	11	45	3.75e-5	SMART
low complexity region	70	109	N/A	INTRINSIC
Pfam:PINIT	126	278	1.1e-38	PFAM
Pfam:zf-MIZ	323	372	1.7e-22	PFAM
low complexity region	608	617	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107076
AA Change: L312P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000102691
Gene: ENSMUSG00000028101
AA Change: L312P

Domain	Start	End	E-Value	Type
SAP	2	36	3.75e-5	SMART
low complexity region	61	100	N/A	INTRINSIC
Pfam:PINIT	113	269	1.1e-45	PFAM
Pfam:zf-Nse	305	361	8e-7	PFAM
Pfam:zf-MIZ	314	363	2.2e-21	PFAM
low complexity region	599	608	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107077
AA Change: L286P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102692
Gene: ENSMUSG00000028101
AA Change: L286P

Domain	Start	End	E-Value	Type
SAP	11	45	3.75e-5	SMART
Pfam:PINIT	87	243	5.3e-46	PFAM
Pfam:zf-Nse	279	335	2.4e-7	PFAM
Pfam:zf-MIZ	288	337	7.4e-22	PFAM
low complexity region	573	582	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161296

Predicted Effect

probably benign
Transcript: ENSMUST00000162156

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162707

Predicted Effect

probably benign
Transcript: ENSMUST00000162778

SMART Domains

Protein: ENSMUSP00000125377
Gene: ENSMUSG00000028101

Domain	Start	End	E-Value	Type
SAP	2	36	3.75e-5	SMART
low complexity region	61	84	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000162934
AA Change: L312P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125747
Gene: ENSMUSG00000028101
AA Change: L312P

Domain	Start	End	E-Value	Type
SAP	2	36	3.75e-5	SMART
low complexity region	61	100	N/A	INTRINSIC
Pfam:PINIT	113	269	1.3e-46	PFAM
Pfam:zf-Nse	305	361	7e-8	PFAM
Pfam:zf-MIZ	314	363	2.6e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171249

SMART Domains

Protein: ENSMUSP00000129851
Gene: ENSMUSG00000028100

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
Pfam:NUDIX	92	235	1.2e-18	PFAM
low complexity region	256	271	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176288

Predicted Effect

probably benign
Transcript: ENSMUST00000176302

SMART Domains

Protein: ENSMUSP00000134835
Gene: ENSMUSG00000028101

Domain	Start	End	E-Value	Type
SAP	2	36	2.57e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196773

Predicted Effect

probably benign
Transcript: ENSMUST00000200387

SMART Domains

Protein: ENSMUSP00000142879
Gene: ENSMUSG00000028100

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:NUDIX	79	125	4.2e-6	PFAM

Meta Mutation Damage Score

0.7688

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PIAS [protein inhibitor of activated STAT (signal transducer and activator of transcription)] family of transcriptional modulators. The protein functions as a SUMO (small ubiquitin-like modifier)-E3 ligase which catalyzes the covalent attachment of a SUMO protein to specific target substrates. It directly binds to several transcription factors and either blocks or enhances their activity. Alternatively spliced transcript variants of this gene have been identified, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Double KO mice display a retinal phenotype reduced M-cone response at P21 and reduced S-cone and rod responses from 7 months. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930486L24Rik	A	T	13: 60,845,114	D250E	probably damaging	Het
4930571K23Rik	A	G	7: 125,369,029		noncoding transcript	Het
9530053A07Rik	T	A	7: 28,154,347	C1579S	probably damaging	Het
Acsl3	T	C	1: 78,705,397		probably benign	Het
Acsl6	C	A	11: 54,329,966	T244K	probably damaging	Het
Adam26b	T	A	8: 43,520,963	N334I	probably damaging	Het
Adgrl4	C	T	3: 151,517,611	T608M	probably damaging	Het
Aldh2	A	G	5: 121,578,341		probably null	Het
Alms1	A	G	6: 85,622,454	T1890A	possibly damaging	Het
C87977	A	C	4: 144,208,592	I193S	probably damaging	Het
Capn7	C	T	14: 31,360,160	T441M	probably damaging	Het
Cd9	A	T	6: 125,464,404	C85S	probably damaging	Het
Chrm3	T	C	13: 9,878,758	T81A	probably damaging	Het
Ctif	A	G	18: 75,624,305		probably benign	Het
Dcc	T	A	18: 71,370,737	D950V	probably damaging	Het
Eif4g1	T	C	16: 20,679,780	V422A	probably damaging	Het
Enthd1	A	G	15: 80,452,923	S437P	probably damaging	Het
Fads1	A	G	19: 10,194,100		probably benign	Het
Fat3	T	A	9: 15,944,880	I3869L	probably benign	Het
Fbxw5	T	A	2: 25,502,461	V85E	possibly damaging	Het
Fem1b	T	C	9: 62,797,174	D268G	possibly damaging	Het
Focad	T	C	4: 88,408,988	L1772P	probably damaging	Het
Gm9573	A	C	17: 35,620,648		probably benign	Het
Gm9833	G	A	3: 10,089,553	V461I	possibly damaging	Het
Gtf3a	C	A	5: 146,951,913	Q145K	possibly damaging	Het
Hacl1	T	C	14: 31,621,000		probably null	Het
Herc2	T	A	7: 56,153,905	F2229L	probably benign	Het
Hs3st4	A	T	7: 124,396,857	I249L	probably benign	Het
Iqsec1	A	T	6: 90,809,770	Y7*	probably null	Het
Klk1b1	T	A	7: 43,970,326	M103K	probably benign	Het
Krt5	A	G	15: 101,710,585	V287A	probably benign	Het
Lgals12	T	A	19: 7,604,165	Q59L	possibly damaging	Het
Loxl4	A	G	19: 42,604,940	V264A	possibly damaging	Het
Lrmp	A	G	6: 145,137,615		probably benign	Het
Lrp1b	T	C	2: 40,822,683	D3099G	probably damaging	Het
Mical3	G	A	6: 121,007,408	T169I	possibly damaging	Het
Myh7b	A	C	2: 155,620,134	S317R	probably damaging	Het
Nrbp1	T	A	5: 31,245,813	I210N	probably damaging	Het
Nsd1	A	T	13: 55,214,059		probably null	Het
Nupl1	A	T	14: 60,244,670		probably benign	Het
Olfr152	T	A	2: 87,782,585	I15N	possibly damaging	Het
Olfr190	A	G	16: 59,074,907	Y58H	probably damaging	Het
Olfr331	A	T	11: 58,501,676	S293R	probably damaging	Het
Olfr346	C	T	2: 36,688,247	L82F	probably damaging	Het
Olfr769	T	C	10: 129,111,868	T186A	probably benign	Het
Pcnx2	A	G	8: 125,850,348	Y982H	probably damaging	Het
Plekhm1	G	A	11: 103,376,884	P754S	probably damaging	Het
Ppp2r5c	T	A	12: 110,545,623	L145*	probably null	Het
Ppp2r5c	T	A	12: 110,561,472		probably benign	Het
Proser3	T	C	7: 30,540,021	M553V	probably benign	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Smurf2	A	T	11: 106,824,688	D664E	possibly damaging	Het
Spag9	G	A	11: 93,996,565	A99T	probably benign	Het
Stim1	T	G	7: 102,354,506	C49G	probably damaging	Het
Stk32c	T	C	7: 139,121,824	I238V	probably benign	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Tfb2m	T	A	1: 179,544,899	E133V	probably null	Het
Tmem209	A	T	6: 30,497,868	C143S	probably benign	Het
Tnr	T	G	1: 159,852,030	N191K	probably benign	Het
Vars	C	T	17: 34,998,222	A419T	probably benign	Het
Vmn2r111	T	C	17: 22,548,060	S819G	probably benign	Het
Wls	T	C	3: 159,897,358	V136A	probably benign	Het
Ybx2	C	T	11: 69,940,061	S217L	probably benign	Het
Zfp82	T	C	7: 30,057,354	D37G	probably benign	Het

Other mutations in Pias3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00958:Pias3	APN	3	96699422	splice site	probably benign
IGL01370:Pias3	APN	3	96703575	missense	probably damaging	0.96
IGL01806:Pias3	APN	3	96703757	missense	probably benign	0.02
IGL02533:Pias3	APN	3	96699616	missense	possibly damaging	0.71
IGL02998:Pias3	APN	3	96702179	missense	probably damaging	0.98
IGL03304:Pias3	APN	3	96700031	missense	possibly damaging	0.65
R0764:Pias3	UTSW	3	96701295	missense	probably damaging	1.00
R1611:Pias3	UTSW	3	96699697	splice site	probably null
R1751:Pias3	UTSW	3	96701403	missense	probably damaging	1.00
R1767:Pias3	UTSW	3	96701403	missense	probably damaging	1.00
R2184:Pias3	UTSW	3	96702221	missense	possibly damaging	0.92
R2257:Pias3	UTSW	3	96699646	missense	probably benign	0.22
R2398:Pias3	UTSW	3	96703813	missense	probably benign	0.00
R2851:Pias3	UTSW	3	96703537	missense	possibly damaging	0.94
R3845:Pias3	UTSW	3	96702210	missense	probably benign	0.28
R4127:Pias3	UTSW	3	96699666	missense	probably damaging	0.97
R4500:Pias3	UTSW	3	96701418	missense	probably damaging	1.00
R4628:Pias3	UTSW	3	96699820	missense	probably damaging	1.00
R5068:Pias3	UTSW	3	96703855	missense	probably damaging	0.98
R5108:Pias3	UTSW	3	96704937	missense	possibly damaging	0.88
R5477:Pias3	UTSW	3	96705003	missense	probably damaging	0.99
R5498:Pias3	UTSW	3	96702188	missense	possibly damaging	0.89
R6457:Pias3	UTSW	3	96699523	missense	possibly damaging	0.81
R6966:Pias3	UTSW	3	96702195	missense	probably damaging	0.99
R7235:Pias3	UTSW	3	96704363	missense	probably benign
R7538:Pias3	UTSW	3	96702218	missense	possibly damaging	0.91
R7552:Pias3	UTSW	3	96701385	frame shift	probably null
R8791:Pias3	UTSW	3	96704885	missense	probably benign	0.22
R8815:Pias3	UTSW	3	96700065	missense	probably damaging	0.98
R9197:Pias3	UTSW	3	96703748	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- TGTGATATACCATGAGTCCCCGCC -3'
(R):5'- AGCAATGCCGTGGAACAATTCAATG -3'

Sequencing Primer
(F):5'- ATGAGTCCCCGCCTCTAC -3'
(R):5'- agggtgctgaagtccttaatg -3'

Posted On

2014-05-14