Incidental Mutation 'R1697:Aldh2'
ID192316
Institutional Source Beutler Lab
Gene Symbol Aldh2
Ensembl Gene ENSMUSG00000029455
Gene Namealdehyde dehydrogenase 2, mitochondrial
SynonymsAhd5, Ahd-5
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1697 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location121566027-121593824 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 121578341 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031411] [ENSMUST00000129753] [ENSMUST00000152945] [ENSMUST00000199369]
Predicted Effect probably null
Transcript: ENSMUST00000031411
SMART Domains Protein: ENSMUSP00000031411
Gene: ENSMUSG00000029455

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Aldedh 47 510 2.9e-185 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129753
SMART Domains Protein: ENSMUSP00000142906
Gene: ENSMUSG00000029455

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Aldedh 47 471 1e-170 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133033
Predicted Effect probably null
Transcript: ENSMUST00000152945
SMART Domains Protein: ENSMUSP00000123545
Gene: ENSMUSG00000029455

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Aldedh 47 185 1.8e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000199369
SMART Domains Protein: ENSMUSP00000143261
Gene: ENSMUSG00000029455

DomainStartEndE-ValueType
Pfam:Aldedh 1 129 4.2e-43 PFAM
Pfam:Aldedh 125 220 3.6e-36 PFAM
Meta Mutation Damage Score 0.9487 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. Two major liver isoforms of aldehyde dehydrogenase, cytosolic and mitochondrial, can be distinguished by their electrophoretic mobilities, kinetic properties, and subcellular localizations. Most Caucasians have two major isozymes, while approximately 50% of East Asians have the cytosolic isozyme but not the mitochondrial isozyme. A remarkably higher frequency of acute alcohol intoxication among East Asians than among Caucasians could be related to the absence of a catalytically active form of the mitochondrial isozyme. The increased exposure to acetaldehyde in individuals with the catalytically inactive form may also confer greater susceptibility to many types of cancer. This gene encodes a mitochondrial isoform, which has a low Km for acetaldehydes, and is localized in mitochondrial matrix. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mutation of this gene results in the absence of oxidation activity in the mitochondria. Mice homozygous for a different allele exhibit decreased litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Aldh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01813:Aldh2 APN 5 121572073 missense probably benign 0.00
IGL02145:Aldh2 APN 5 121567993 makesense probably null
IGL02352:Aldh2 APN 5 121575897 missense probably null 1.00
IGL02359:Aldh2 APN 5 121575897 missense probably null 1.00
IGL02473:Aldh2 APN 5 121572078 missense probably damaging 1.00
IGL02818:Aldh2 APN 5 121575125 missense probably benign
IGL03182:Aldh2 APN 5 121580724 unclassified probably benign
IGL03324:Aldh2 APN 5 121575125 missense probably benign
Flushed UTSW 5 121572816 nonsense probably null
R0595:Aldh2 UTSW 5 121573500 missense probably damaging 0.99
R0595:Aldh2 UTSW 5 121573501 missense probably damaging 0.97
R1992:Aldh2 UTSW 5 121575963 missense possibly damaging 0.93
R2174:Aldh2 UTSW 5 121572668 intron probably benign
R4786:Aldh2 UTSW 5 121572824 missense probably benign 0.21
R4793:Aldh2 UTSW 5 121568979 missense probably damaging 0.99
R5408:Aldh2 UTSW 5 121570557 intron probably benign
R5934:Aldh2 UTSW 5 121579615 missense probably benign
R6266:Aldh2 UTSW 5 121568934 missense probably damaging 0.97
R6294:Aldh2 UTSW 5 121572816 nonsense probably null
R6792:Aldh2 UTSW 5 121580649 missense probably damaging 0.98
R7659:Aldh2 UTSW 5 121568960 missense probably damaging 1.00
R9070:Aldh2 UTSW 5 121568969 missense probably damaging 1.00
X0009:Aldh2 UTSW 5 121572774 missense possibly damaging 0.94
X0027:Aldh2 UTSW 5 121593462 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGAACAACTGTCGAGCCTTTAGCC -3'
(R):5'- TACCGGAGACAATCAGTGGTCCAG -3'

Sequencing Primer
(F):5'- ATTTCGTTCCGAGGACCACAG -3'
(R):5'- TCAGTGGTCCAGAGGAGACTC -3'
Posted On2014-05-14