Incidental Mutation 'R1697:Gtf3a'
ID 192317
Institutional Source Beutler Lab
Gene Symbol Gtf3a
Ensembl Gene ENSMUSG00000016503
Gene Name general transcription factor III A
Synonyms 2610111I01Rik, 2010015D03Rik, 5330403M05Rik
MMRRC Submission 039730-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.938) question?
Stock # R1697 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 146885467-146892424 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 146888723 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 145 (Q145K)
Ref Sequence ENSEMBL: ENSMUSP00000115824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016654] [ENSMUST00000066675] [ENSMUST00000110564] [ENSMUST00000110566] [ENSMUST00000132102] [ENSMUST00000146511]
AlphaFold Q8VHT7
Predicted Effect probably benign
Transcript: ENSMUST00000016654
SMART Domains Protein: ENSMUSP00000016654
Gene: ENSMUSG00000016510

DomainStartEndE-ValueType
Pfam:IF3_N 70 144 5e-16 PFAM
Pfam:IF3_C 152 240 1.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066675
SMART Domains Protein: ENSMUSP00000063398
Gene: ENSMUSG00000016510

DomainStartEndE-ValueType
Pfam:IF3_N 73 144 2.1e-13 PFAM
Pfam:IF3_C 153 238 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110564
SMART Domains Protein: ENSMUSP00000106193
Gene: ENSMUSG00000016510

DomainStartEndE-ValueType
Pfam:IF3_N 70 144 5e-16 PFAM
Pfam:IF3_C 152 240 1.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110566
SMART Domains Protein: ENSMUSP00000106195
Gene: ENSMUSG00000016510

DomainStartEndE-ValueType
Pfam:IF3_N 70 144 5e-16 PFAM
Pfam:IF3_C 152 240 1.8e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000132102
AA Change: Q145K

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115824
Gene: ENSMUSG00000016503
AA Change: Q145K

DomainStartEndE-ValueType
ZnF_C2H2 38 62 1.86e0 SMART
ZnF_C2H2 68 92 6.32e-3 SMART
ZnF_C2H2 98 123 1.38e-3 SMART
ZnF_C2H2 130 154 1.33e-1 SMART
ZnF_C2H2 160 184 1.45e-2 SMART
ZnF_C2H2 187 211 8.09e-1 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 244 269 3.63e-3 SMART
ZnF_C2H2 275 299 2.09e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133296
Predicted Effect probably benign
Transcript: ENSMUST00000146511
AA Change: Q145K

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000119607
Gene: ENSMUSG00000016503
AA Change: Q145K

DomainStartEndE-ValueType
ZnF_C2H2 38 62 1.86e0 SMART
ZnF_C2H2 68 92 6.32e-3 SMART
ZnF_C2H2 98 123 1.38e-3 SMART
ZnF_C2H2 130 154 1.33e-1 SMART
ZnF_C2H2 160 184 1.45e-2 SMART
ZnF_C2H2 187 211 8.09e-1 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 244 269 3.63e-3 SMART
ZnF_C2H2 275 299 2.09e-3 SMART
low complexity region 338 361 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133682
Meta Mutation Damage Score 0.0841 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: The product of this gene is a zinc finger protein with nine Cis[2]-His[2] zinc finger domains. It functions as an RNA polymerase III transcription factor to induce transcription of the 5S rRNA genes. The protein binds to a 50 bp internal promoter in the 5S genes called the internal control region (ICR), and nucleates formation of a stable preinitiation complex. This complex recruits the TFIIIC and TFIIIB transcription factors and RNA polymerase III to form the complete transcription complex. The protein is thought to be translated using a non-AUG translation initiation site in mammals based on sequence analysis, protein homology, and the size of the purified protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,992,928 (GRCm39) D250E probably damaging Het
4930571K23Rik A G 7: 124,968,201 (GRCm39) noncoding transcript Het
Acsl3 T C 1: 78,683,114 (GRCm39) probably benign Het
Acsl6 C A 11: 54,220,792 (GRCm39) T244K probably damaging Het
Adam26b T A 8: 43,974,000 (GRCm39) N334I probably damaging Het
Adgrl4 C T 3: 151,223,248 (GRCm39) T608M probably damaging Het
Aldh2 A G 5: 121,716,404 (GRCm39) probably null Het
Alms1 A G 6: 85,599,436 (GRCm39) T1890A possibly damaging Het
Capn7 C T 14: 31,082,117 (GRCm39) T441M probably damaging Het
Cd9 A T 6: 125,441,367 (GRCm39) C85S probably damaging Het
Chrm3 T C 13: 9,928,794 (GRCm39) T81A probably damaging Het
Ctif A G 18: 75,757,376 (GRCm39) probably benign Het
Dcc T A 18: 71,503,808 (GRCm39) D950V probably damaging Het
Eif4g1 T C 16: 20,498,530 (GRCm39) V422A probably damaging Het
Enthd1 A G 15: 80,337,124 (GRCm39) S437P probably damaging Het
Fads1 A G 19: 10,171,464 (GRCm39) probably benign Het
Fat3 T A 9: 15,856,176 (GRCm39) I3869L probably benign Het
Fbxw5 T A 2: 25,392,473 (GRCm39) V85E possibly damaging Het
Fcgbpl1 T A 7: 27,853,772 (GRCm39) C1579S probably damaging Het
Fem1b T C 9: 62,704,456 (GRCm39) D268G possibly damaging Het
Focad T C 4: 88,327,225 (GRCm39) L1772P probably damaging Het
Hacl1 T C 14: 31,342,957 (GRCm39) probably null Het
Herc2 T A 7: 55,803,653 (GRCm39) F2229L probably benign Het
Hs3st4 A T 7: 123,996,080 (GRCm39) I249L probably benign Het
Iqsec1 A T 6: 90,786,752 (GRCm39) Y7* probably null Het
Irag2 A G 6: 145,083,341 (GRCm39) probably benign Het
Klk1b1 T A 7: 43,619,750 (GRCm39) M103K probably benign Het
Krt5 A G 15: 101,619,020 (GRCm39) V287A probably benign Het
Lgals12 T A 19: 7,581,530 (GRCm39) Q59L possibly damaging Het
Loxl4 A G 19: 42,593,379 (GRCm39) V264A possibly damaging Het
Lrp1b T C 2: 40,712,695 (GRCm39) D3099G probably damaging Het
Mical3 G A 6: 120,984,369 (GRCm39) T169I possibly damaging Het
Muc21 A C 17: 35,931,540 (GRCm39) probably benign Het
Myef2l G A 3: 10,154,613 (GRCm39) V461I possibly damaging Het
Myh7b A C 2: 155,462,054 (GRCm39) S317R probably damaging Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Nsd1 A T 13: 55,361,872 (GRCm39) probably null Het
Nup58 A T 14: 60,482,119 (GRCm39) probably benign Het
Or1j17 C T 2: 36,578,259 (GRCm39) L82F probably damaging Het
Or2t49 A T 11: 58,392,502 (GRCm39) S293R probably damaging Het
Or5h22 A G 16: 58,895,270 (GRCm39) Y58H probably damaging Het
Or5i1 T A 2: 87,612,929 (GRCm39) I15N possibly damaging Het
Or6c2b T C 10: 128,947,737 (GRCm39) T186A probably benign Het
Pcnx2 A G 8: 126,577,087 (GRCm39) Y982H probably damaging Het
Pias3 T C 3: 96,609,541 (GRCm39) L312P probably damaging Het
Plekhm1 G A 11: 103,267,710 (GRCm39) P754S probably damaging Het
Ppp2r5c T A 12: 110,512,057 (GRCm39) L145* probably null Het
Ppp2r5c T A 12: 110,527,906 (GRCm39) probably benign Het
Pramel29 A C 4: 143,935,162 (GRCm39) I193S probably damaging Het
Proser3 T C 7: 30,239,446 (GRCm39) M553V probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Smurf2 A T 11: 106,715,514 (GRCm39) D664E possibly damaging Het
Spag9 G A 11: 93,887,391 (GRCm39) A99T probably benign Het
Stim1 T G 7: 102,003,713 (GRCm39) C49G probably damaging Het
Stk32c T C 7: 138,701,740 (GRCm39) I238V probably benign Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Tfb2m T A 1: 179,372,464 (GRCm39) E133V probably null Het
Tmem209 A T 6: 30,497,867 (GRCm39) C143S probably benign Het
Tnr T G 1: 159,679,600 (GRCm39) N191K probably benign Het
Vars1 C T 17: 35,217,198 (GRCm39) A419T probably benign Het
Vmn2r111 T C 17: 22,767,041 (GRCm39) S819G probably benign Het
Wls T C 3: 159,602,995 (GRCm39) V136A probably benign Het
Ybx2 C T 11: 69,830,887 (GRCm39) S217L probably benign Het
Zfp82 T C 7: 29,756,779 (GRCm39) D37G probably benign Het
Other mutations in Gtf3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03096:Gtf3a APN 5 146,890,763 (GRCm39) missense probably damaging 1.00
IGL03404:Gtf3a APN 5 146,887,449 (GRCm39) splice site probably null
R0227:Gtf3a UTSW 5 146,892,199 (GRCm39) missense probably damaging 1.00
R0365:Gtf3a UTSW 5 146,885,747 (GRCm39) missense probably damaging 1.00
R0480:Gtf3a UTSW 5 146,890,039 (GRCm39) missense probably damaging 1.00
R2171:Gtf3a UTSW 5 146,892,272 (GRCm39) missense probably benign 0.00
R3917:Gtf3a UTSW 5 146,892,244 (GRCm39) missense probably benign 0.26
R4867:Gtf3a UTSW 5 146,888,723 (GRCm39) nonsense probably null
R5081:Gtf3a UTSW 5 146,888,092 (GRCm39) missense probably benign 0.36
R5268:Gtf3a UTSW 5 146,891,965 (GRCm39) missense probably damaging 1.00
R6056:Gtf3a UTSW 5 146,892,338 (GRCm39) unclassified probably benign
R6376:Gtf3a UTSW 5 146,890,798 (GRCm39) splice site probably null
R7151:Gtf3a UTSW 5 146,888,085 (GRCm39) missense probably benign 0.01
R8855:Gtf3a UTSW 5 146,885,721 (GRCm39) missense probably benign 0.00
Z1176:Gtf3a UTSW 5 146,888,014 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGCATGGGCTATCCCCATT -3'
(R):5'- GCAGGGCCTCATTACTCCTGTTCTA -3'

Sequencing Primer
(F):5'- ggtcagaagagggtgtgag -3'
(R):5'- AAAGCCCTCATGACACAGAG -3'
Posted On 2014-05-14