Incidental Mutation 'R1697:Mical3'
ID 192321
Institutional Source Beutler Lab
Gene Symbol Mical3
Ensembl Gene ENSMUSG00000051586
Gene Name microtubule associated monooxygenase, calponin and LIM domain containing 3
Synonyms C130040D16Rik, MICAL-3
MMRRC Submission 039730-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.163) question?
Stock # R1697 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 120908668-121107959 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 120984369 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 169 (T169I)
Ref Sequence ENSEMBL: ENSMUSP00000144882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077159] [ENSMUST00000203254] [ENSMUST00000204302] [ENSMUST00000205030] [ENSMUST00000207889]
AlphaFold Q8CJ19
Predicted Effect probably benign
Transcript: ENSMUST00000077159
AA Change: T817I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000076402
Gene: ENSMUSG00000051586
AA Change: T817I

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:FAD_binding_3 86 142 1.4e-7 PFAM
low complexity region 162 175 N/A INTRINSIC
CH 520 619 4.44e-17 SMART
low complexity region 625 635 N/A INTRINSIC
LIM 763 815 2.78e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098457
SMART Domains Protein: ENSMUSP00000096056
Gene: ENSMUSG00000051586

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 57 80 N/A INTRINSIC
coiled coil region 114 148 N/A INTRINSIC
low complexity region 191 225 N/A INTRINSIC
coiled coil region 238 265 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 582 592 N/A INTRINSIC
low complexity region 625 637 N/A INTRINSIC
low complexity region 794 824 N/A INTRINSIC
low complexity region 861 882 N/A INTRINSIC
low complexity region 911 929 N/A INTRINSIC
low complexity region 950 962 N/A INTRINSIC
DUF3585 968 1110 1.39e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150503
SMART Domains Protein: ENSMUSP00000115131
Gene: ENSMUSG00000051586

DomainStartEndE-ValueType
SCOP:d1bjt__ 41 141 8e-3 SMART
coiled coil region 192 219 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 328 337 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 536 546 N/A INTRINSIC
low complexity region 579 591 N/A INTRINSIC
low complexity region 748 778 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203254
SMART Domains Protein: ENSMUSP00000145254
Gene: ENSMUSG00000051586

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:FAD_binding_3 86 142 8.6e-6 PFAM
low complexity region 162 175 N/A INTRINSIC
CH 520 619 2.2e-19 SMART
low complexity region 640 655 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204302
SMART Domains Protein: ENSMUSP00000144972
Gene: ENSMUSG00000051586

DomainStartEndE-ValueType
LIM 82 136 5.39e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000205030
AA Change: T169I

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144882
Gene: ENSMUSG00000051586
AA Change: T169I

DomainStartEndE-ValueType
LIM 115 167 1.4e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000212208
AA Change: T403I
Predicted Effect probably benign
Transcript: ENSMUST00000207889
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,992,928 (GRCm39) D250E probably damaging Het
4930571K23Rik A G 7: 124,968,201 (GRCm39) noncoding transcript Het
Acsl3 T C 1: 78,683,114 (GRCm39) probably benign Het
Acsl6 C A 11: 54,220,792 (GRCm39) T244K probably damaging Het
Adam26b T A 8: 43,974,000 (GRCm39) N334I probably damaging Het
Adgrl4 C T 3: 151,223,248 (GRCm39) T608M probably damaging Het
Aldh2 A G 5: 121,716,404 (GRCm39) probably null Het
Alms1 A G 6: 85,599,436 (GRCm39) T1890A possibly damaging Het
Capn7 C T 14: 31,082,117 (GRCm39) T441M probably damaging Het
Cd9 A T 6: 125,441,367 (GRCm39) C85S probably damaging Het
Chrm3 T C 13: 9,928,794 (GRCm39) T81A probably damaging Het
Ctif A G 18: 75,757,376 (GRCm39) probably benign Het
Dcc T A 18: 71,503,808 (GRCm39) D950V probably damaging Het
Eif4g1 T C 16: 20,498,530 (GRCm39) V422A probably damaging Het
Enthd1 A G 15: 80,337,124 (GRCm39) S437P probably damaging Het
Fads1 A G 19: 10,171,464 (GRCm39) probably benign Het
Fat3 T A 9: 15,856,176 (GRCm39) I3869L probably benign Het
Fbxw5 T A 2: 25,392,473 (GRCm39) V85E possibly damaging Het
Fcgbpl1 T A 7: 27,853,772 (GRCm39) C1579S probably damaging Het
Fem1b T C 9: 62,704,456 (GRCm39) D268G possibly damaging Het
Focad T C 4: 88,327,225 (GRCm39) L1772P probably damaging Het
Gtf3a C A 5: 146,888,723 (GRCm39) Q145K possibly damaging Het
Hacl1 T C 14: 31,342,957 (GRCm39) probably null Het
Herc2 T A 7: 55,803,653 (GRCm39) F2229L probably benign Het
Hs3st4 A T 7: 123,996,080 (GRCm39) I249L probably benign Het
Iqsec1 A T 6: 90,786,752 (GRCm39) Y7* probably null Het
Irag2 A G 6: 145,083,341 (GRCm39) probably benign Het
Klk1b1 T A 7: 43,619,750 (GRCm39) M103K probably benign Het
Krt5 A G 15: 101,619,020 (GRCm39) V287A probably benign Het
Lgals12 T A 19: 7,581,530 (GRCm39) Q59L possibly damaging Het
Loxl4 A G 19: 42,593,379 (GRCm39) V264A possibly damaging Het
Lrp1b T C 2: 40,712,695 (GRCm39) D3099G probably damaging Het
Muc21 A C 17: 35,931,540 (GRCm39) probably benign Het
Myef2l G A 3: 10,154,613 (GRCm39) V461I possibly damaging Het
Myh7b A C 2: 155,462,054 (GRCm39) S317R probably damaging Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Nsd1 A T 13: 55,361,872 (GRCm39) probably null Het
Nup58 A T 14: 60,482,119 (GRCm39) probably benign Het
Or1j17 C T 2: 36,578,259 (GRCm39) L82F probably damaging Het
Or2t49 A T 11: 58,392,502 (GRCm39) S293R probably damaging Het
Or5h22 A G 16: 58,895,270 (GRCm39) Y58H probably damaging Het
Or5i1 T A 2: 87,612,929 (GRCm39) I15N possibly damaging Het
Or6c2b T C 10: 128,947,737 (GRCm39) T186A probably benign Het
Pcnx2 A G 8: 126,577,087 (GRCm39) Y982H probably damaging Het
Pias3 T C 3: 96,609,541 (GRCm39) L312P probably damaging Het
Plekhm1 G A 11: 103,267,710 (GRCm39) P754S probably damaging Het
Ppp2r5c T A 12: 110,512,057 (GRCm39) L145* probably null Het
Ppp2r5c T A 12: 110,527,906 (GRCm39) probably benign Het
Pramel29 A C 4: 143,935,162 (GRCm39) I193S probably damaging Het
Proser3 T C 7: 30,239,446 (GRCm39) M553V probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Smurf2 A T 11: 106,715,514 (GRCm39) D664E possibly damaging Het
Spag9 G A 11: 93,887,391 (GRCm39) A99T probably benign Het
Stim1 T G 7: 102,003,713 (GRCm39) C49G probably damaging Het
Stk32c T C 7: 138,701,740 (GRCm39) I238V probably benign Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Tfb2m T A 1: 179,372,464 (GRCm39) E133V probably null Het
Tmem209 A T 6: 30,497,867 (GRCm39) C143S probably benign Het
Tnr T G 1: 159,679,600 (GRCm39) N191K probably benign Het
Vars1 C T 17: 35,217,198 (GRCm39) A419T probably benign Het
Vmn2r111 T C 17: 22,767,041 (GRCm39) S819G probably benign Het
Wls T C 3: 159,602,995 (GRCm39) V136A probably benign Het
Ybx2 C T 11: 69,830,887 (GRCm39) S217L probably benign Het
Zfp82 T C 7: 29,756,779 (GRCm39) D37G probably benign Het
Other mutations in Mical3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Mical3 APN 6 120,938,585 (GRCm39) missense possibly damaging 0.73
IGL00718:Mical3 APN 6 121,017,410 (GRCm39) missense probably damaging 0.98
IGL00940:Mical3 APN 6 120,999,371 (GRCm39) missense possibly damaging 0.55
IGL00973:Mical3 APN 6 120,911,885 (GRCm39) splice site probably benign
IGL01503:Mical3 APN 6 120,935,537 (GRCm39) missense probably benign 0.09
IGL01991:Mical3 APN 6 120,912,172 (GRCm39) missense probably damaging 0.98
IGL02794:Mical3 APN 6 120,984,270 (GRCm39) missense probably damaging 0.99
IGL02996:Mical3 APN 6 120,935,519 (GRCm39) missense probably damaging 1.00
IGL03105:Mical3 APN 6 121,019,199 (GRCm39) missense probably benign 0.01
IGL03109:Mical3 APN 6 120,986,085 (GRCm39) missense probably damaging 1.00
IGL03236:Mical3 APN 6 120,946,345 (GRCm39) missense probably benign 0.00
P0028:Mical3 UTSW 6 121,001,650 (GRCm39) missense probably benign 0.33
R0244:Mical3 UTSW 6 120,934,683 (GRCm39) missense probably benign 0.00
R0494:Mical3 UTSW 6 120,936,162 (GRCm39) missense possibly damaging 0.94
R0586:Mical3 UTSW 6 121,006,602 (GRCm39) unclassified probably benign
R1029:Mical3 UTSW 6 120,911,639 (GRCm39) missense probably benign 0.02
R1263:Mical3 UTSW 6 120,929,430 (GRCm39) missense probably damaging 0.99
R1507:Mical3 UTSW 6 121,019,199 (GRCm39) missense probably benign 0.36
R1527:Mical3 UTSW 6 121,001,740 (GRCm39) missense probably damaging 0.99
R1623:Mical3 UTSW 6 121,001,768 (GRCm39) missense probably damaging 0.99
R1680:Mical3 UTSW 6 120,936,604 (GRCm39) missense probably benign 0.09
R1817:Mical3 UTSW 6 121,019,196 (GRCm39) missense probably benign 0.06
R1875:Mical3 UTSW 6 121,019,025 (GRCm39) missense probably damaging 1.00
R1961:Mical3 UTSW 6 120,959,568 (GRCm39) missense possibly damaging 0.94
R2004:Mical3 UTSW 6 120,928,283 (GRCm39) missense probably damaging 1.00
R2093:Mical3 UTSW 6 121,017,347 (GRCm39) missense probably damaging 1.00
R2141:Mical3 UTSW 6 121,008,095 (GRCm39) splice site probably null
R2142:Mical3 UTSW 6 121,008,095 (GRCm39) splice site probably null
R2257:Mical3 UTSW 6 121,010,696 (GRCm39) missense possibly damaging 0.94
R2404:Mical3 UTSW 6 120,936,789 (GRCm39) missense probably benign 0.01
R2419:Mical3 UTSW 6 120,936,884 (GRCm39) missense probably benign
R2509:Mical3 UTSW 6 121,011,118 (GRCm39) missense probably damaging 1.00
R3784:Mical3 UTSW 6 120,998,298 (GRCm39) missense probably benign 0.00
R4342:Mical3 UTSW 6 120,911,799 (GRCm39) nonsense probably null
R4343:Mical3 UTSW 6 120,911,799 (GRCm39) nonsense probably null
R4579:Mical3 UTSW 6 120,935,660 (GRCm39) missense probably benign
R4603:Mical3 UTSW 6 120,911,799 (GRCm39) nonsense probably null
R4605:Mical3 UTSW 6 121,011,041 (GRCm39) nonsense probably null
R4610:Mical3 UTSW 6 120,911,799 (GRCm39) nonsense probably null
R4611:Mical3 UTSW 6 120,911,799 (GRCm39) nonsense probably null
R4623:Mical3 UTSW 6 120,938,586 (GRCm39) nonsense probably null
R4669:Mical3 UTSW 6 120,934,664 (GRCm39) missense probably damaging 0.98
R4704:Mical3 UTSW 6 120,935,649 (GRCm39) missense probably benign 0.00
R4722:Mical3 UTSW 6 121,015,486 (GRCm39) missense probably benign 0.00
R4863:Mical3 UTSW 6 121,010,748 (GRCm39) missense probably damaging 0.99
R4878:Mical3 UTSW 6 120,946,348 (GRCm39) missense possibly damaging 0.51
R4885:Mical3 UTSW 6 120,912,214 (GRCm39) missense probably damaging 1.00
R4907:Mical3 UTSW 6 120,984,259 (GRCm39) missense probably benign 0.00
R5007:Mical3 UTSW 6 121,015,030 (GRCm39) missense probably damaging 0.98
R5299:Mical3 UTSW 6 120,936,473 (GRCm39) missense possibly damaging 0.71
R5303:Mical3 UTSW 6 120,936,941 (GRCm39) missense probably benign
R5368:Mical3 UTSW 6 120,936,434 (GRCm39) missense probably damaging 1.00
R5955:Mical3 UTSW 6 121,010,711 (GRCm39) missense probably damaging 0.99
R5970:Mical3 UTSW 6 120,935,232 (GRCm39) nonsense probably null
R6000:Mical3 UTSW 6 120,998,281 (GRCm39) missense probably benign 0.06
R6101:Mical3 UTSW 6 121,010,671 (GRCm39) missense probably damaging 1.00
R6195:Mical3 UTSW 6 120,993,796 (GRCm39) intron probably benign
R6210:Mical3 UTSW 6 121,017,478 (GRCm39) splice site probably null
R6225:Mical3 UTSW 6 120,935,684 (GRCm39) missense probably damaging 0.98
R6258:Mical3 UTSW 6 120,985,991 (GRCm39) missense probably damaging 1.00
R6260:Mical3 UTSW 6 120,985,991 (GRCm39) missense probably damaging 1.00
R6349:Mical3 UTSW 6 120,936,486 (GRCm39) missense probably benign
R6352:Mical3 UTSW 6 120,929,434 (GRCm39) missense probably damaging 0.97
R6480:Mical3 UTSW 6 121,011,236 (GRCm39) missense possibly damaging 0.76
R6704:Mical3 UTSW 6 120,986,761 (GRCm39) intron probably benign
R6783:Mical3 UTSW 6 120,935,786 (GRCm39) missense possibly damaging 0.85
R6925:Mical3 UTSW 6 120,936,351 (GRCm39) missense probably benign 0.05
R6960:Mical3 UTSW 6 120,935,504 (GRCm39) missense probably damaging 1.00
R7170:Mical3 UTSW 6 120,950,694 (GRCm39) splice site probably null
R7344:Mical3 UTSW 6 121,013,505 (GRCm39) nonsense probably null
R7414:Mical3 UTSW 6 121,011,074 (GRCm39) missense probably damaging 1.00
R7455:Mical3 UTSW 6 120,935,705 (GRCm39) missense probably damaging 1.00
R7649:Mical3 UTSW 6 120,911,909 (GRCm39) missense probably damaging 1.00
R8236:Mical3 UTSW 6 120,989,504 (GRCm39) missense
R8286:Mical3 UTSW 6 120,998,149 (GRCm39) missense possibly damaging 0.68
R8316:Mical3 UTSW 6 120,911,944 (GRCm39) missense probably damaging 1.00
R8328:Mical3 UTSW 6 120,912,138 (GRCm39) missense probably damaging 0.98
R8354:Mical3 UTSW 6 120,950,381 (GRCm39) missense probably damaging 0.99
R8511:Mical3 UTSW 6 121,015,513 (GRCm39) missense possibly damaging 0.78
R8687:Mical3 UTSW 6 120,936,438 (GRCm39) missense probably benign 0.19
R8728:Mical3 UTSW 6 120,950,514 (GRCm39) missense probably damaging 0.99
R8925:Mical3 UTSW 6 120,984,325 (GRCm39) missense probably benign 0.00
R8927:Mical3 UTSW 6 120,984,325 (GRCm39) missense probably benign 0.00
R8986:Mical3 UTSW 6 120,991,822 (GRCm39) missense
R9026:Mical3 UTSW 6 120,986,848 (GRCm39) splice site probably benign
R9415:Mical3 UTSW 6 120,934,712 (GRCm39) missense probably damaging 1.00
R9515:Mical3 UTSW 6 121,001,758 (GRCm39) missense probably damaging 1.00
R9720:Mical3 UTSW 6 120,935,238 (GRCm39) missense probably damaging 0.99
R9777:Mical3 UTSW 6 120,959,529 (GRCm39) missense possibly damaging 0.91
U24488:Mical3 UTSW 6 120,978,457 (GRCm39) missense possibly damaging 0.90
Z1177:Mical3 UTSW 6 120,936,689 (GRCm39) missense possibly damaging 0.71
Z1190:Mical3 UTSW 6 120,998,319 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACAATGGCTCCGTTCTCAGGAAAG -3'
(R):5'- TGAGGCAAAGCACGCTGATCTTAC -3'

Sequencing Primer
(F):5'- ctcaaactcactccgtagacc -3'
(R):5'- CTTCCATCTCTAAGACACCACTGG -3'
Posted On 2014-05-14