Incidental Mutation 'R1697:Mical3'
ID192321
Institutional Source Beutler Lab
Gene Symbol Mical3
Ensembl Gene ENSMUSG00000051586
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing 3
SynonymsMICAL-3, C130040D16Rik
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R1697 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location120931707-121130999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121007408 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 169 (T169I)
Ref Sequence ENSEMBL: ENSMUSP00000144882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077159] [ENSMUST00000203254] [ENSMUST00000204302] [ENSMUST00000205030] [ENSMUST00000207889]
AlphaFold Q8CJ19
Predicted Effect probably benign
Transcript: ENSMUST00000077159
AA Change: T817I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000076402
Gene: ENSMUSG00000051586
AA Change: T817I

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:FAD_binding_3 86 142 1.4e-7 PFAM
low complexity region 162 175 N/A INTRINSIC
CH 520 619 4.44e-17 SMART
low complexity region 625 635 N/A INTRINSIC
LIM 763 815 2.78e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098457
SMART Domains Protein: ENSMUSP00000096056
Gene: ENSMUSG00000051586

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 57 80 N/A INTRINSIC
coiled coil region 114 148 N/A INTRINSIC
low complexity region 191 225 N/A INTRINSIC
coiled coil region 238 265 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 582 592 N/A INTRINSIC
low complexity region 625 637 N/A INTRINSIC
low complexity region 794 824 N/A INTRINSIC
low complexity region 861 882 N/A INTRINSIC
low complexity region 911 929 N/A INTRINSIC
low complexity region 950 962 N/A INTRINSIC
DUF3585 968 1110 1.39e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150503
SMART Domains Protein: ENSMUSP00000115131
Gene: ENSMUSG00000051586

DomainStartEndE-ValueType
SCOP:d1bjt__ 41 141 8e-3 SMART
coiled coil region 192 219 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 328 337 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 536 546 N/A INTRINSIC
low complexity region 579 591 N/A INTRINSIC
low complexity region 748 778 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203254
SMART Domains Protein: ENSMUSP00000145254
Gene: ENSMUSG00000051586

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:FAD_binding_3 86 142 8.6e-6 PFAM
low complexity region 162 175 N/A INTRINSIC
CH 520 619 2.2e-19 SMART
low complexity region 640 655 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204302
SMART Domains Protein: ENSMUSP00000144972
Gene: ENSMUSG00000051586

DomainStartEndE-ValueType
LIM 82 136 5.39e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000205030
AA Change: T169I

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144882
Gene: ENSMUSG00000051586
AA Change: T169I

DomainStartEndE-ValueType
LIM 115 167 1.4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207889
Predicted Effect unknown
Transcript: ENSMUST00000212208
AA Change: T403I
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Mical3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Mical3 APN 6 120961624 missense possibly damaging 0.73
IGL00718:Mical3 APN 6 121040449 missense probably damaging 0.98
IGL00940:Mical3 APN 6 121022410 missense possibly damaging 0.55
IGL00973:Mical3 APN 6 120934924 splice site probably benign
IGL01503:Mical3 APN 6 120958576 missense probably benign 0.09
IGL01991:Mical3 APN 6 120935211 missense probably damaging 0.98
IGL02794:Mical3 APN 6 121007309 missense probably damaging 0.99
IGL02996:Mical3 APN 6 120958558 missense probably damaging 1.00
IGL03105:Mical3 APN 6 121042238 missense probably benign 0.01
IGL03109:Mical3 APN 6 121009124 missense probably damaging 1.00
IGL03236:Mical3 APN 6 120969384 missense probably benign 0.00
P0028:Mical3 UTSW 6 121024689 missense probably benign 0.33
R0244:Mical3 UTSW 6 120957722 missense probably benign 0.00
R0494:Mical3 UTSW 6 120959201 missense possibly damaging 0.94
R0586:Mical3 UTSW 6 121029641 unclassified probably benign
R1029:Mical3 UTSW 6 120934678 missense probably benign 0.02
R1263:Mical3 UTSW 6 120952469 missense probably damaging 0.99
R1507:Mical3 UTSW 6 121042238 missense probably benign 0.36
R1527:Mical3 UTSW 6 121024779 missense probably damaging 0.99
R1623:Mical3 UTSW 6 121024807 missense probably damaging 0.99
R1680:Mical3 UTSW 6 120959643 missense probably benign 0.09
R1817:Mical3 UTSW 6 121042235 missense probably benign 0.06
R1875:Mical3 UTSW 6 121042064 missense probably damaging 1.00
R1961:Mical3 UTSW 6 120982607 missense possibly damaging 0.94
R2004:Mical3 UTSW 6 120951322 missense probably damaging 1.00
R2093:Mical3 UTSW 6 121040386 missense probably damaging 1.00
R2141:Mical3 UTSW 6 121031134 splice site probably null
R2142:Mical3 UTSW 6 121031134 splice site probably null
R2257:Mical3 UTSW 6 121033735 missense possibly damaging 0.94
R2404:Mical3 UTSW 6 120959828 missense probably benign 0.01
R2419:Mical3 UTSW 6 120959923 missense probably benign
R2509:Mical3 UTSW 6 121034157 missense probably damaging 1.00
R3784:Mical3 UTSW 6 121021337 missense probably benign 0.00
R4342:Mical3 UTSW 6 120934838 nonsense probably null
R4343:Mical3 UTSW 6 120934838 nonsense probably null
R4579:Mical3 UTSW 6 120958699 missense probably benign
R4603:Mical3 UTSW 6 120934838 nonsense probably null
R4605:Mical3 UTSW 6 121034080 nonsense probably null
R4610:Mical3 UTSW 6 120934838 nonsense probably null
R4611:Mical3 UTSW 6 120934838 nonsense probably null
R4623:Mical3 UTSW 6 120961625 nonsense probably null
R4669:Mical3 UTSW 6 120957703 missense probably damaging 0.98
R4704:Mical3 UTSW 6 120958688 missense probably benign 0.00
R4722:Mical3 UTSW 6 121038525 missense probably benign 0.00
R4863:Mical3 UTSW 6 121033787 missense probably damaging 0.99
R4878:Mical3 UTSW 6 120969387 missense possibly damaging 0.51
R4885:Mical3 UTSW 6 120935253 missense probably damaging 1.00
R4907:Mical3 UTSW 6 121007298 missense probably benign 0.00
R5007:Mical3 UTSW 6 121038069 missense probably damaging 0.98
R5299:Mical3 UTSW 6 120959512 missense possibly damaging 0.71
R5303:Mical3 UTSW 6 120959980 missense probably benign
R5368:Mical3 UTSW 6 120959473 missense probably damaging 1.00
R5955:Mical3 UTSW 6 121033750 missense probably damaging 0.99
R5970:Mical3 UTSW 6 120958271 nonsense probably null
R6000:Mical3 UTSW 6 121021320 missense probably benign 0.06
R6101:Mical3 UTSW 6 121033710 missense probably damaging 1.00
R6195:Mical3 UTSW 6 121016835 intron probably benign
R6210:Mical3 UTSW 6 121040517 splice site probably null
R6225:Mical3 UTSW 6 120958723 missense probably damaging 0.98
R6258:Mical3 UTSW 6 121009030 missense probably damaging 1.00
R6260:Mical3 UTSW 6 121009030 missense probably damaging 1.00
R6349:Mical3 UTSW 6 120959525 missense probably benign
R6352:Mical3 UTSW 6 120952473 missense probably damaging 0.97
R6480:Mical3 UTSW 6 121034275 missense possibly damaging 0.76
R6704:Mical3 UTSW 6 121009800 intron probably benign
R6783:Mical3 UTSW 6 120958825 missense possibly damaging 0.85
R6925:Mical3 UTSW 6 120959390 missense probably benign 0.05
R6960:Mical3 UTSW 6 120958543 missense probably damaging 1.00
R7170:Mical3 UTSW 6 120973733 splice site probably null
R7344:Mical3 UTSW 6 121036544 nonsense probably null
R7414:Mical3 UTSW 6 121034113 missense probably damaging 1.00
R7455:Mical3 UTSW 6 120958744 missense probably damaging 1.00
R7649:Mical3 UTSW 6 120934948 missense probably damaging 1.00
R8236:Mical3 UTSW 6 121012543 missense
R8286:Mical3 UTSW 6 121021188 missense possibly damaging 0.68
R8316:Mical3 UTSW 6 120934983 missense probably damaging 1.00
R8328:Mical3 UTSW 6 120935177 missense probably damaging 0.98
R8354:Mical3 UTSW 6 120973420 missense probably damaging 0.99
R8511:Mical3 UTSW 6 121038552 missense possibly damaging 0.78
R8687:Mical3 UTSW 6 120959477 missense probably benign 0.19
R8728:Mical3 UTSW 6 120973553 missense probably damaging 0.99
R8925:Mical3 UTSW 6 121007364 missense probably benign 0.00
R8927:Mical3 UTSW 6 121007364 missense probably benign 0.00
R8986:Mical3 UTSW 6 121014861 missense
U24488:Mical3 UTSW 6 121001496 missense possibly damaging 0.90
Z1177:Mical3 UTSW 6 120959728 missense possibly damaging 0.71
Z1190:Mical3 UTSW 6 121021358 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACAATGGCTCCGTTCTCAGGAAAG -3'
(R):5'- TGAGGCAAAGCACGCTGATCTTAC -3'

Sequencing Primer
(F):5'- ctcaaactcactccgtagacc -3'
(R):5'- CTTCCATCTCTAAGACACCACTGG -3'
Posted On2014-05-14