Incidental Mutation 'R1697:Cd9'
ID192322
Institutional Source Beutler Lab
Gene Symbol Cd9
Ensembl Gene ENSMUSG00000030342
Gene NameCD9 antigen
SynonymsTspan29
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R1697 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location125460266-125494791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125464404 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 85 (C85S)
Ref Sequence ENSEMBL: ENSMUSP00000032492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032492]
Predicted Effect probably damaging
Transcript: ENSMUST00000032492
AA Change: C85S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032492
Gene: ENSMUSG00000030342
AA Change: C85S

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 219 2.9e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140024
Meta Mutation Damage Score 0.9428 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Tetraspanins are cell surface glycoproteins with four transmembrane domains that form multimeric complexes with other cell surface proteins. The encoded protein functions in many cellular processes including differentiation, adhesion, and signal transduction, and expression of this gene plays a critical role in the suppression of cancer cell motility and metastasis. [provided by RefSeq, Jan 2011]
PHENOTYPE: Females homozygous for targeted null mutations are infertile due to lack of sperm-egg fusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Cd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02496:Cd9 APN 6 125472495 missense probably damaging 1.00
R0255:Cd9 UTSW 6 125463740 missense probably damaging 1.00
R0472:Cd9 UTSW 6 125472433 missense probably benign
R0738:Cd9 UTSW 6 125462140 missense probably benign 0.00
R2085:Cd9 UTSW 6 125463771 splice site probably null
R4201:Cd9 UTSW 6 125462394 missense possibly damaging 0.56
R4961:Cd9 UTSW 6 125463740 missense probably damaging 1.00
R5580:Cd9 UTSW 6 125464457 missense probably damaging 1.00
R6627:Cd9 UTSW 6 125462412 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGCTTGCAGAACAGTTAGCGTG -3'
(R):5'- TGTCCCTAGAATCGAGGCAGTCAAC -3'

Sequencing Primer
(F):5'- GAAAATGTGATCTGCTGCCCC -3'
(R):5'- TCGAGGCAGTCAACAAGGAG -3'
Posted On2014-05-14