Incidental Mutation 'R1697:Irag2'
ID 192323
Institutional Source Beutler Lab
Gene Symbol Irag2
Ensembl Gene ENSMUSG00000030263
Gene Name inositol 1,4,5-triphosphate receptor associated 2
Synonyms Jaw1, Lrmp, D6Int7, D6Int8, D6Int5, D6Int4, D6Int3
MMRRC Submission 039730-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1697 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 145061379-145120660 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 145083341 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032396] [ENSMUST00000135984] [ENSMUST00000152571]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032396
SMART Domains Protein: ENSMUSP00000032396
Gene: ENSMUSG00000030263

DomainStartEndE-ValueType
Pfam:MRVI1 10 539 3.2e-265 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149244
Predicted Effect probably benign
Transcript: ENSMUST00000152571
SMART Domains Protein: ENSMUSP00000120166
Gene: ENSMUSG00000030263

DomainStartEndE-ValueType
Pfam:MRVI1 9 198 2.2e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204561
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encode dby this gene is expressed in a developmentally regulated manner in lymphoid cell lines and tissues. The protein is localized to the cytoplasmic face of the endoplasmic reticulum. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,992,928 (GRCm39) D250E probably damaging Het
4930571K23Rik A G 7: 124,968,201 (GRCm39) noncoding transcript Het
Acsl3 T C 1: 78,683,114 (GRCm39) probably benign Het
Acsl6 C A 11: 54,220,792 (GRCm39) T244K probably damaging Het
Adam26b T A 8: 43,974,000 (GRCm39) N334I probably damaging Het
Adgrl4 C T 3: 151,223,248 (GRCm39) T608M probably damaging Het
Aldh2 A G 5: 121,716,404 (GRCm39) probably null Het
Alms1 A G 6: 85,599,436 (GRCm39) T1890A possibly damaging Het
Capn7 C T 14: 31,082,117 (GRCm39) T441M probably damaging Het
Cd9 A T 6: 125,441,367 (GRCm39) C85S probably damaging Het
Chrm3 T C 13: 9,928,794 (GRCm39) T81A probably damaging Het
Ctif A G 18: 75,757,376 (GRCm39) probably benign Het
Dcc T A 18: 71,503,808 (GRCm39) D950V probably damaging Het
Eif4g1 T C 16: 20,498,530 (GRCm39) V422A probably damaging Het
Enthd1 A G 15: 80,337,124 (GRCm39) S437P probably damaging Het
Fads1 A G 19: 10,171,464 (GRCm39) probably benign Het
Fat3 T A 9: 15,856,176 (GRCm39) I3869L probably benign Het
Fbxw5 T A 2: 25,392,473 (GRCm39) V85E possibly damaging Het
Fcgbpl1 T A 7: 27,853,772 (GRCm39) C1579S probably damaging Het
Fem1b T C 9: 62,704,456 (GRCm39) D268G possibly damaging Het
Focad T C 4: 88,327,225 (GRCm39) L1772P probably damaging Het
Gtf3a C A 5: 146,888,723 (GRCm39) Q145K possibly damaging Het
Hacl1 T C 14: 31,342,957 (GRCm39) probably null Het
Herc2 T A 7: 55,803,653 (GRCm39) F2229L probably benign Het
Hs3st4 A T 7: 123,996,080 (GRCm39) I249L probably benign Het
Iqsec1 A T 6: 90,786,752 (GRCm39) Y7* probably null Het
Klk1b1 T A 7: 43,619,750 (GRCm39) M103K probably benign Het
Krt5 A G 15: 101,619,020 (GRCm39) V287A probably benign Het
Lgals12 T A 19: 7,581,530 (GRCm39) Q59L possibly damaging Het
Loxl4 A G 19: 42,593,379 (GRCm39) V264A possibly damaging Het
Lrp1b T C 2: 40,712,695 (GRCm39) D3099G probably damaging Het
Mical3 G A 6: 120,984,369 (GRCm39) T169I possibly damaging Het
Muc21 A C 17: 35,931,540 (GRCm39) probably benign Het
Myef2l G A 3: 10,154,613 (GRCm39) V461I possibly damaging Het
Myh7b A C 2: 155,462,054 (GRCm39) S317R probably damaging Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Nsd1 A T 13: 55,361,872 (GRCm39) probably null Het
Nup58 A T 14: 60,482,119 (GRCm39) probably benign Het
Or1j17 C T 2: 36,578,259 (GRCm39) L82F probably damaging Het
Or2t49 A T 11: 58,392,502 (GRCm39) S293R probably damaging Het
Or5h22 A G 16: 58,895,270 (GRCm39) Y58H probably damaging Het
Or5i1 T A 2: 87,612,929 (GRCm39) I15N possibly damaging Het
Or6c2b T C 10: 128,947,737 (GRCm39) T186A probably benign Het
Pcnx2 A G 8: 126,577,087 (GRCm39) Y982H probably damaging Het
Pias3 T C 3: 96,609,541 (GRCm39) L312P probably damaging Het
Plekhm1 G A 11: 103,267,710 (GRCm39) P754S probably damaging Het
Ppp2r5c T A 12: 110,512,057 (GRCm39) L145* probably null Het
Ppp2r5c T A 12: 110,527,906 (GRCm39) probably benign Het
Pramel29 A C 4: 143,935,162 (GRCm39) I193S probably damaging Het
Proser3 T C 7: 30,239,446 (GRCm39) M553V probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Smurf2 A T 11: 106,715,514 (GRCm39) D664E possibly damaging Het
Spag9 G A 11: 93,887,391 (GRCm39) A99T probably benign Het
Stim1 T G 7: 102,003,713 (GRCm39) C49G probably damaging Het
Stk32c T C 7: 138,701,740 (GRCm39) I238V probably benign Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Tfb2m T A 1: 179,372,464 (GRCm39) E133V probably null Het
Tmem209 A T 6: 30,497,867 (GRCm39) C143S probably benign Het
Tnr T G 1: 159,679,600 (GRCm39) N191K probably benign Het
Vars1 C T 17: 35,217,198 (GRCm39) A419T probably benign Het
Vmn2r111 T C 17: 22,767,041 (GRCm39) S819G probably benign Het
Wls T C 3: 159,602,995 (GRCm39) V136A probably benign Het
Ybx2 C T 11: 69,830,887 (GRCm39) S217L probably benign Het
Zfp82 T C 7: 29,756,779 (GRCm39) D37G probably benign Het
Other mutations in Irag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Irag2 APN 6 145,113,720 (GRCm39) missense probably damaging 1.00
IGL01066:Irag2 APN 6 145,106,681 (GRCm39) missense probably damaging 1.00
IGL01877:Irag2 APN 6 145,093,525 (GRCm39) missense probably damaging 0.99
IGL02154:Irag2 APN 6 145,083,967 (GRCm39) missense possibly damaging 0.92
IGL02727:Irag2 APN 6 145,120,344 (GRCm39) missense possibly damaging 0.78
FR4976:Irag2 UTSW 6 145,119,511 (GRCm39) unclassified probably benign
R0238:Irag2 UTSW 6 145,117,704 (GRCm39) unclassified probably benign
R0239:Irag2 UTSW 6 145,117,704 (GRCm39) unclassified probably benign
R0454:Irag2 UTSW 6 145,113,710 (GRCm39) missense possibly damaging 0.73
R0485:Irag2 UTSW 6 145,110,938 (GRCm39) missense probably damaging 1.00
R0487:Irag2 UTSW 6 145,110,986 (GRCm39) missense probably benign 0.02
R0554:Irag2 UTSW 6 145,111,013 (GRCm39) missense probably benign 0.01
R0634:Irag2 UTSW 6 145,120,354 (GRCm39) missense probably damaging 0.98
R1440:Irag2 UTSW 6 145,120,237 (GRCm39) missense possibly damaging 0.77
R1574:Irag2 UTSW 6 145,104,356 (GRCm39) splice site probably benign
R1968:Irag2 UTSW 6 145,115,499 (GRCm39) missense probably damaging 0.98
R3735:Irag2 UTSW 6 145,106,596 (GRCm39) splice site probably benign
R3736:Irag2 UTSW 6 145,106,596 (GRCm39) splice site probably benign
R4643:Irag2 UTSW 6 145,113,786 (GRCm39) missense probably benign 0.17
R4812:Irag2 UTSW 6 145,093,737 (GRCm39) missense probably damaging 1.00
R4916:Irag2 UTSW 6 145,111,027 (GRCm39) missense probably damaging 1.00
R5183:Irag2 UTSW 6 145,083,946 (GRCm39) missense probably benign 0.23
R5845:Irag2 UTSW 6 145,117,392 (GRCm39) missense probably benign 0.00
R6701:Irag2 UTSW 6 145,090,702 (GRCm39) nonsense probably null
R6735:Irag2 UTSW 6 145,106,619 (GRCm39) missense probably damaging 1.00
R7083:Irag2 UTSW 6 145,115,509 (GRCm39) missense probably damaging 1.00
R7317:Irag2 UTSW 6 145,104,424 (GRCm39) missense possibly damaging 0.93
R7468:Irag2 UTSW 6 145,119,427 (GRCm39) splice site probably null
R8429:Irag2 UTSW 6 145,110,949 (GRCm39) missense probably damaging 1.00
R8485:Irag2 UTSW 6 145,117,400 (GRCm39) missense probably damaging 1.00
R8779:Irag2 UTSW 6 145,083,925 (GRCm39) missense probably benign 0.00
R8955:Irag2 UTSW 6 145,117,390 (GRCm39) missense probably benign
R9034:Irag2 UTSW 6 145,083,273 (GRCm39) missense probably benign
R9487:Irag2 UTSW 6 145,120,257 (GRCm39) missense probably benign 0.00
R9488:Irag2 UTSW 6 145,113,753 (GRCm39) missense probably damaging 1.00
R9676:Irag2 UTSW 6 145,120,338 (GRCm39) missense probably damaging 1.00
RF003:Irag2 UTSW 6 145,119,509 (GRCm39) unclassified probably benign
RF015:Irag2 UTSW 6 145,119,509 (GRCm39) unclassified probably benign
RF017:Irag2 UTSW 6 145,119,510 (GRCm39) unclassified probably benign
RF027:Irag2 UTSW 6 145,119,516 (GRCm39) unclassified probably benign
RF029:Irag2 UTSW 6 145,119,516 (GRCm39) unclassified probably benign
RF030:Irag2 UTSW 6 145,119,516 (GRCm39) unclassified probably benign
RF030:Irag2 UTSW 6 145,119,514 (GRCm39) unclassified probably benign
RF038:Irag2 UTSW 6 145,119,516 (GRCm39) unclassified probably benign
RF043:Irag2 UTSW 6 145,119,516 (GRCm39) unclassified probably benign
RF044:Irag2 UTSW 6 145,119,516 (GRCm39) unclassified probably benign
RF048:Irag2 UTSW 6 145,119,510 (GRCm39) unclassified probably benign
RF052:Irag2 UTSW 6 145,106,257 (GRCm39) critical splice acceptor site probably benign
RF054:Irag2 UTSW 6 145,119,514 (GRCm39) unclassified probably benign
RF055:Irag2 UTSW 6 145,119,511 (GRCm39) unclassified probably benign
Z1177:Irag2 UTSW 6 145,093,800 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTGCAACCAATCTCTTGGGTG -3'
(R):5'- TACGGCATAGGGAGTCTGAACCAC -3'

Sequencing Primer
(F):5'- CCAATCTCTTGGGTGAGAAAAG -3'
(R):5'- CATGACTCATCGGGGTTAACG -3'
Posted On 2014-05-14