Mutagenetix > Incidental Mutation

Incidental Mutation 'R1697:9530053A07Rik'

192325

Institutional Source

Beutler Lab

Gene Symbol

9530053A07Rik

Ensembl Gene

ENSMUSG00000078776

Gene Name

RIKEN cDNA 9530053A07 gene

Synonyms

MMRRC Submission

039730-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R1697 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

28129466-28164811 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 28154347 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 1579 (C1579S)

Ref Sequence

ENSEMBL: ENSMUSP00000114986 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]

AlphaFold

E9PVG8

Predicted Effect

probably damaging
Transcript: ENSMUST00000059886
AA Change: C1579S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: C1579S

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
FOLN	27	49	1.23e-4	SMART
VWD	46	211	1.5e-40	SMART
C8	251	326	4.31e-33	SMART
Pfam:TIL	329	383	2e-13	PFAM
VWC	385	448	1.02e0	SMART
VWD	439	603	4.32e-32	SMART
C8	640	715	4.54e-9	SMART
Pfam:TIL	718	771	1.6e-12	PFAM
VWC	773	826	1.1e0	SMART
FOLN	805	827	6.87e1	SMART
VWD	825	988	7.92e-40	SMART
C8	1033	1108	5.1e-35	SMART
Pfam:TIL	1111	1164	7.6e-11	PFAM
VWC	1166	1224	1.1e-2	SMART
FOLN	1197	1219	9.55e-1	SMART
FOLN	1223	1245	5.38e1	SMART
VWD	1241	1410	9.04e-35	SMART
C8	1450	1526	9.54e-26	SMART
low complexity region	1540	1550	N/A	INTRINSIC
EGF_like	1557	1580	5.34e1	SMART
VWC	1588	1681	3.21e-3	SMART
VWD	1639	1806	7.3e-30	SMART
C8	1838	1913	2.44e-32	SMART
EGF_like	1941	1964	4.46e1	SMART
VWC	1971	2062	2.85e-1	SMART
VWD	2022	2178	1.32e-27	SMART
low complexity region	2199	2212	N/A	INTRINSIC
C8	2219	2294	1.43e-29	SMART
Pfam:TIL	2297	2350	1.1e-11	PFAM
FOLN	2383	2405	5.68e1	SMART
VWD	2402	2564	4.58e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000150948
AA Change: C1579S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: C1579S

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
FOLN	27	49	1.23e-4	SMART
VWD	46	211	1.5e-40	SMART
C8	251	326	4.31e-33	SMART
Pfam:TIL	329	383	2e-13	PFAM
VWC	385	448	1.02e0	SMART
VWD	439	603	4.32e-32	SMART
C8	640	715	4.54e-9	SMART
Pfam:TIL	718	771	1.6e-12	PFAM
VWC	773	826	1.1e0	SMART
FOLN	805	827	6.87e1	SMART
VWD	825	988	7.92e-40	SMART
C8	1033	1108	5.1e-35	SMART
Pfam:TIL	1111	1164	7.6e-11	PFAM
VWC	1166	1224	1.1e-2	SMART
FOLN	1197	1219	9.55e-1	SMART
FOLN	1223	1245	5.38e1	SMART
VWD	1241	1410	9.04e-35	SMART
C8	1450	1526	9.54e-26	SMART
low complexity region	1540	1550	N/A	INTRINSIC
EGF_like	1557	1580	5.34e1	SMART
VWC	1588	1681	3.21e-3	SMART
VWD	1639	1806	7.3e-30	SMART
C8	1838	1913	2.44e-32	SMART
EGF_like	1941	1964	4.46e1	SMART
VWC	1971	2062	2.85e-1	SMART
VWD	2022	2178	1.32e-27	SMART
low complexity region	2199	2212	N/A	INTRINSIC
C8	2219	2294	1.43e-29	SMART
Pfam:TIL	2297	2350	1.1e-11	PFAM
FOLN	2383	2405	5.68e1	SMART
VWD	2402	2564	4.58e-4	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

99% (67/68)

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930486L24Rik	A	T	13: 60,845,114	D250E	probably damaging	Het
4930571K23Rik	A	G	7: 125,369,029		noncoding transcript	Het
Acsl3	T	C	1: 78,705,397		probably benign	Het
Acsl6	C	A	11: 54,329,966	T244K	probably damaging	Het
Adam26b	T	A	8: 43,520,963	N334I	probably damaging	Het
Adgrl4	C	T	3: 151,517,611	T608M	probably damaging	Het
Aldh2	A	G	5: 121,578,341		probably null	Het
Alms1	A	G	6: 85,622,454	T1890A	possibly damaging	Het
C87977	A	C	4: 144,208,592	I193S	probably damaging	Het
Capn7	C	T	14: 31,360,160	T441M	probably damaging	Het
Cd9	A	T	6: 125,464,404	C85S	probably damaging	Het
Chrm3	T	C	13: 9,878,758	T81A	probably damaging	Het
Ctif	A	G	18: 75,624,305		probably benign	Het
Dcc	T	A	18: 71,370,737	D950V	probably damaging	Het
Eif4g1	T	C	16: 20,679,780	V422A	probably damaging	Het
Enthd1	A	G	15: 80,452,923	S437P	probably damaging	Het
Fads1	A	G	19: 10,194,100		probably benign	Het
Fat3	T	A	9: 15,944,880	I3869L	probably benign	Het
Fbxw5	T	A	2: 25,502,461	V85E	possibly damaging	Het
Fem1b	T	C	9: 62,797,174	D268G	possibly damaging	Het
Focad	T	C	4: 88,408,988	L1772P	probably damaging	Het
Gm9573	A	C	17: 35,620,648		probably benign	Het
Gm9833	G	A	3: 10,089,553	V461I	possibly damaging	Het
Gtf3a	C	A	5: 146,951,913	Q145K	possibly damaging	Het
Hacl1	T	C	14: 31,621,000		probably null	Het
Herc2	T	A	7: 56,153,905	F2229L	probably benign	Het
Hs3st4	A	T	7: 124,396,857	I249L	probably benign	Het
Iqsec1	A	T	6: 90,809,770	Y7*	probably null	Het
Klk1b1	T	A	7: 43,970,326	M103K	probably benign	Het
Krt5	A	G	15: 101,710,585	V287A	probably benign	Het
Lgals12	T	A	19: 7,604,165	Q59L	possibly damaging	Het
Loxl4	A	G	19: 42,604,940	V264A	possibly damaging	Het
Lrmp	A	G	6: 145,137,615		probably benign	Het
Lrp1b	T	C	2: 40,822,683	D3099G	probably damaging	Het
Mical3	G	A	6: 121,007,408	T169I	possibly damaging	Het
Myh7b	A	C	2: 155,620,134	S317R	probably damaging	Het
Nrbp1	T	A	5: 31,245,813	I210N	probably damaging	Het
Nsd1	A	T	13: 55,214,059		probably null	Het
Nupl1	A	T	14: 60,244,670		probably benign	Het
Olfr152	T	A	2: 87,782,585	I15N	possibly damaging	Het
Olfr190	A	G	16: 59,074,907	Y58H	probably damaging	Het
Olfr331	A	T	11: 58,501,676	S293R	probably damaging	Het
Olfr346	C	T	2: 36,688,247	L82F	probably damaging	Het
Olfr769	T	C	10: 129,111,868	T186A	probably benign	Het
Pcnx2	A	G	8: 125,850,348	Y982H	probably damaging	Het
Pias3	T	C	3: 96,702,225	L312P	probably damaging	Het
Plekhm1	G	A	11: 103,376,884	P754S	probably damaging	Het
Ppp2r5c	T	A	12: 110,545,623	L145*	probably null	Het
Ppp2r5c	T	A	12: 110,561,472		probably benign	Het
Proser3	T	C	7: 30,540,021	M553V	probably benign	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Smurf2	A	T	11: 106,824,688	D664E	possibly damaging	Het
Spag9	G	A	11: 93,996,565	A99T	probably benign	Het
Stim1	T	G	7: 102,354,506	C49G	probably damaging	Het
Stk32c	T	C	7: 139,121,824	I238V	probably benign	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Tfb2m	T	A	1: 179,544,899	E133V	probably null	Het
Tmem209	A	T	6: 30,497,868	C143S	probably benign	Het
Tnr	T	G	1: 159,852,030	N191K	probably benign	Het
Vars	C	T	17: 34,998,222	A419T	probably benign	Het
Vmn2r111	T	C	17: 22,548,060	S819G	probably benign	Het
Wls	T	C	3: 159,897,358	V136A	probably benign	Het
Ybx2	C	T	11: 69,940,061	S217L	probably benign	Het
Zfp82	T	C	7: 30,057,354	D37G	probably benign	Het

Other mutations in 9530053A07Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:9530053A07Rik	APN	7	28164528	missense	probably damaging	1.00
IGL00757:9530053A07Rik	APN	7	28154445	missense	probably damaging	1.00
IGL01015:9530053A07Rik	APN	7	28155318	missense	probably damaging	1.00
IGL01079:9530053A07Rik	APN	7	28139778	missense	probably damaging	0.99
IGL01343:9530053A07Rik	APN	7	28150702	missense	probably benign	0.19
IGL01420:9530053A07Rik	APN	7	28140133	missense	probably benign	0.28
IGL01604:9530053A07Rik	APN	7	28155324	missense	probably benign	0.11
IGL01666:9530053A07Rik	APN	7	28153292	missense	probably damaging	1.00
IGL02002:9530053A07Rik	APN	7	28152796	missense	probably damaging	1.00
IGL02036:9530053A07Rik	APN	7	28137525	missense	possibly damaging	0.82
IGL02126:9530053A07Rik	APN	7	28139856	missense	probably damaging	1.00
IGL02150:9530053A07Rik	APN	7	28146779	nonsense	probably null
IGL02219:9530053A07Rik	APN	7	28154635	missense	probably damaging	1.00
IGL02563:9530053A07Rik	APN	7	28157892	missense	probably benign
IGL02804:9530053A07Rik	APN	7	28153370	missense	probably benign	0.00
IGL02830:9530053A07Rik	APN	7	28162923	missense	probably damaging	1.00
IGL02943:9530053A07Rik	APN	7	28147188	missense	probably damaging	1.00
IGL02977:9530053A07Rik	APN	7	28164372	missense	possibly damaging	0.83
IGL03231:9530053A07Rik	APN	7	28153722	missense	possibly damaging	0.95
IGL03304:9530053A07Rik	APN	7	28142242	missense	probably damaging	0.99
herz	UTSW	7	28153839	missense	possibly damaging	0.72
pulse	UTSW	7	28153749	missense	probably damaging	1.00
Sinusoidal	UTSW	7	28140130	missense	probably damaging	1.00
PIT4378001:9530053A07Rik	UTSW	7	28154464	missense	possibly damaging	0.61
R0023:9530053A07Rik	UTSW	7	28153412	missense	probably benign	0.00
R0131:9530053A07Rik	UTSW	7	28137615	missense	probably damaging	1.00
R0131:9530053A07Rik	UTSW	7	28137615	missense	probably damaging	1.00
R0132:9530053A07Rik	UTSW	7	28137615	missense	probably damaging	1.00
R0158:9530053A07Rik	UTSW	7	28155492	missense	probably damaging	1.00
R0230:9530053A07Rik	UTSW	7	28156825	missense	probably damaging	1.00
R0310:9530053A07Rik	UTSW	7	28142274	missense	probably benign	0.04
R0448:9530053A07Rik	UTSW	7	28140235	missense	probably benign	0.03
R0462:9530053A07Rik	UTSW	7	28137340	missense	probably damaging	1.00
R0481:9530053A07Rik	UTSW	7	28153749	missense	probably damaging	1.00
R0497:9530053A07Rik	UTSW	7	28147465	missense	probably damaging	1.00
R0556:9530053A07Rik	UTSW	7	28159378	missense	probably benign
R0562:9530053A07Rik	UTSW	7	28162690	missense	probably benign	0.30
R0586:9530053A07Rik	UTSW	7	28137091	missense	probably damaging	0.99
R0924:9530053A07Rik	UTSW	7	28140130	missense	probably damaging	1.00
R0930:9530053A07Rik	UTSW	7	28140130	missense	probably damaging	1.00
R1103:9530053A07Rik	UTSW	7	28154520	missense	probably damaging	1.00
R1213:9530053A07Rik	UTSW	7	28157673	missense	probably damaging	1.00
R1292:9530053A07Rik	UTSW	7	28142794	splice site	probably benign
R1368:9530053A07Rik	UTSW	7	28159478	missense	possibly damaging	0.89
R1451:9530053A07Rik	UTSW	7	28137157	missense	probably damaging	1.00
R1477:9530053A07Rik	UTSW	7	28157093	missense	probably benign	0.01
R1538:9530053A07Rik	UTSW	7	28155492	missense	probably damaging	1.00
R1655:9530053A07Rik	UTSW	7	28147110	missense	probably damaging	0.98
R1741:9530053A07Rik	UTSW	7	28157854	missense	probably damaging	0.98
R1796:9530053A07Rik	UTSW	7	28155372	missense	probably damaging	1.00
R1853:9530053A07Rik	UTSW	7	28155546	nonsense	probably null
R1861:9530053A07Rik	UTSW	7	28154732	missense	probably damaging	1.00
R1909:9530053A07Rik	UTSW	7	28144348	missense	possibly damaging	0.52
R1971:9530053A07Rik	UTSW	7	28131512	missense	possibly damaging	0.90
R1990:9530053A07Rik	UTSW	7	28154360	missense	probably damaging	0.98
R2020:9530053A07Rik	UTSW	7	28155594	missense	probably benign
R2084:9530053A07Rik	UTSW	7	28157535	missense	probably damaging	1.00
R2125:9530053A07Rik	UTSW	7	28158022	missense	probably benign	0.00
R2132:9530053A07Rik	UTSW	7	28155474	missense	probably damaging	1.00
R2513:9530053A07Rik	UTSW	7	28131635	missense	probably damaging	0.99
R2913:9530053A07Rik	UTSW	7	28164307	missense	probably damaging	1.00
R3150:9530053A07Rik	UTSW	7	28154195	missense	probably benign	0.21
R3499:9530053A07Rik	UTSW	7	28154555	missense	probably benign	0.42
R3702:9530053A07Rik	UTSW	7	28157778	missense	probably damaging	1.00
R3881:9530053A07Rik	UTSW	7	28140038	nonsense	probably null
R3938:9530053A07Rik	UTSW	7	28154294	missense	probably damaging	1.00
R4050:9530053A07Rik	UTSW	7	28152985	missense	possibly damaging	0.55
R4152:9530053A07Rik	UTSW	7	28156897	missense	possibly damaging	0.47
R4168:9530053A07Rik	UTSW	7	28137109	missense	probably benign	0.05
R4235:9530053A07Rik	UTSW	7	28156648	missense	probably damaging	0.99
R4241:9530053A07Rik	UTSW	7	28154335	missense	probably damaging	1.00
R4363:9530053A07Rik	UTSW	7	28146906	missense	probably damaging	1.00
R4460:9530053A07Rik	UTSW	7	28152856	missense	probably benign	0.17
R4463:9530053A07Rik	UTSW	7	28150719	missense	probably benign
R4841:9530053A07Rik	UTSW	7	28150722	missense	probably damaging	1.00
R4842:9530053A07Rik	UTSW	7	28150722	missense	probably damaging	1.00
R4876:9530053A07Rik	UTSW	7	28142800	intron	probably benign
R4905:9530053A07Rik	UTSW	7	28156983	missense	possibly damaging	0.93
R4997:9530053A07Rik	UTSW	7	28143924	missense	possibly damaging	0.77
R5091:9530053A07Rik	UTSW	7	28156958	missense	probably benign	0.44
R5159:9530053A07Rik	UTSW	7	28153308	missense	probably benign	0.09
R5326:9530053A07Rik	UTSW	7	28155489	missense	probably damaging	0.98
R5396:9530053A07Rik	UTSW	7	28140183	missense	probably benign
R5441:9530053A07Rik	UTSW	7	28156914	missense	probably damaging	1.00
R5480:9530053A07Rik	UTSW	7	28157999	nonsense	probably null
R5542:9530053A07Rik	UTSW	7	28155489	missense	probably damaging	0.98
R5571:9530053A07Rik	UTSW	7	28156569	missense	probably damaging	0.99
R5613:9530053A07Rik	UTSW	7	28142878	intron	probably benign
R5637:9530053A07Rik	UTSW	7	28152852	missense	probably benign	0.00
R5766:9530053A07Rik	UTSW	7	28137329	nonsense	probably null
R6174:9530053A07Rik	UTSW	7	28139959	missense	probably damaging	0.96
R6233:9530053A07Rik	UTSW	7	28131460	missense	probably damaging	0.99
R6250:9530053A07Rik	UTSW	7	28150714	missense	probably damaging	1.00
R6379:9530053A07Rik	UTSW	7	28157592	missense	probably damaging	1.00
R6442:9530053A07Rik	UTSW	7	28144186	missense	possibly damaging	0.88
R6478:9530053A07Rik	UTSW	7	28155373	missense	probably damaging	1.00
R6699:9530053A07Rik	UTSW	7	28144368	missense	probably damaging	1.00
R6852:9530053A07Rik	UTSW	7	28147135	missense	probably damaging	1.00
R6883:9530053A07Rik	UTSW	7	28152835	missense	possibly damaging	0.89
R6902:9530053A07Rik	UTSW	7	28137213	missense	probably damaging	1.00
R6903:9530053A07Rik	UTSW	7	28137213	missense	probably damaging	1.00
R6904:9530053A07Rik	UTSW	7	28137213	missense	probably damaging	1.00
R6992:9530053A07Rik	UTSW	7	28140183	missense	probably benign	0.04
R7023:9530053A07Rik	UTSW	7	28140038	nonsense	probably null
R7039:9530053A07Rik	UTSW	7	28140148	missense	possibly damaging	0.80
R7171:9530053A07Rik	UTSW	7	28154519	nonsense	probably null
R7282:9530053A07Rik	UTSW	7	28144408	missense	probably benign	0.02
R7291:9530053A07Rik	UTSW	7	28140220	missense	probably benign
R7344:9530053A07Rik	UTSW	7	28140279	missense	possibly damaging	0.79
R7344:9530053A07Rik	UTSW	7	28152760	missense	possibly damaging	0.46
R7392:9530053A07Rik	UTSW	7	28164372	missense	possibly damaging	0.83
R7531:9530053A07Rik	UTSW	7	28140231	missense	probably benign
R7541:9530053A07Rik	UTSW	7	28144256	nonsense	probably null
R7577:9530053A07Rik	UTSW	7	28154423	missense	possibly damaging	0.65
R7594:9530053A07Rik	UTSW	7	28131460	missense	probably damaging	0.99
R7647:9530053A07Rik	UTSW	7	28140045	missense	probably benign	0.00
R7718:9530053A07Rik	UTSW	7	28147201	missense	probably damaging	1.00
R7733:9530053A07Rik	UTSW	7	28139965	missense	probably damaging	1.00
R7737:9530053A07Rik	UTSW	7	28157073	missense	probably damaging	1.00
R7908:9530053A07Rik	UTSW	7	28147496	missense	probably benign	0.12
R8013:9530053A07Rik	UTSW	7	28137541	missense	probably benign	0.14
R8014:9530053A07Rik	UTSW	7	28137541	missense	probably benign	0.14
R8151:9530053A07Rik	UTSW	7	28153341	missense	possibly damaging	0.95
R8175:9530053A07Rik	UTSW	7	28164448	nonsense	probably null
R8254:9530053A07Rik	UTSW	7	28147349	missense	possibly damaging	0.63
R8345:9530053A07Rik	UTSW	7	28155360	missense	probably damaging	1.00
R8414:9530053A07Rik	UTSW	7	28142733	missense	probably damaging	1.00
R8419:9530053A07Rik	UTSW	7	28143921	missense	probably damaging	1.00
R8496:9530053A07Rik	UTSW	7	28143952	missense	possibly damaging	0.81
R8691:9530053A07Rik	UTSW	7	28153839	missense	possibly damaging	0.72
R8785:9530053A07Rik	UTSW	7	28154707	missense	probably damaging	1.00
R8863:9530053A07Rik	UTSW	7	28131581	missense	probably damaging	1.00
R8926:9530053A07Rik	UTSW	7	28154444	missense	probably damaging	1.00
R8950:9530053A07Rik	UTSW	7	28164326	missense	probably benign	0.32
R9014:9530053A07Rik	UTSW	7	28155451	missense	probably damaging	1.00
R9045:9530053A07Rik	UTSW	7	28154431	missense	probably damaging	1.00
R9115:9530053A07Rik	UTSW	7	28154329	missense	possibly damaging	0.74
R9233:9530053A07Rik	UTSW	7	28140094	missense	possibly damaging	0.83
R9330:9530053A07Rik	UTSW	7	28156985	missense	probably benign	0.02
R9426:9530053A07Rik	UTSW	7	28143856	missense	possibly damaging	0.92
R9477:9530053A07Rik	UTSW	7	28152840	missense	probably damaging	1.00
R9502:9530053A07Rik	UTSW	7	28137466	missense	probably benign	0.09
R9505:9530053A07Rik	UTSW	7	28142484	nonsense	probably null
R9601:9530053A07Rik	UTSW	7	28154380	missense	possibly damaging	0.78
R9630:9530053A07Rik	UTSW	7	28137199	missense	probably damaging	1.00
R9632:9530053A07Rik	UTSW	7	28142301	missense	probably benign
R9673:9530053A07Rik	UTSW	7	28156619	missense	probably benign	0.25
R9735:9530053A07Rik	UTSW	7	28157010	missense	probably damaging	1.00
Z1176:9530053A07Rik	UTSW	7	28142386	missense	probably benign	0.06
Z1176:9530053A07Rik	UTSW	7	28154762	missense	probably benign	0.03
Z1177:9530053A07Rik	UTSW	7	28139898	missense	probably benign	0.25
Z1186:9530053A07Rik	UTSW	7	28131572	missense	probably benign
Z1186:9530053A07Rik	UTSW	7	28146705	missense	probably benign	0.00
Z1186:9530053A07Rik	UTSW	7	28156986	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCTACAGAGATCACCTGCCCTGTC -3'
(R):5'- GGCTGCACCTATGCTCATTAACCAC -3'

Sequencing Primer
(F):5'- TGTCAACAGCCACTACGAG -3'
(R):5'- TGGGATCACCCAGTATTTGAC -3'

Posted On

2014-05-14