Incidental Mutation 'R1697:Zfp82'
ID192326
Institutional Source Beutler Lab
Gene Symbol Zfp82
Ensembl Gene ENSMUSG00000098022
Gene Namezinc finger protein 82
SynonymsKRAB16
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R1697 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30054489-30072900 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30057354 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 37 (D37G)
Ref Sequence ENSEMBL: ENSMUSP00000138677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080834] [ENSMUST00000182546] [ENSMUST00000182746] [ENSMUST00000182919] [ENSMUST00000183115] [ENSMUST00000183190]
Predicted Effect probably benign
Transcript: ENSMUST00000080834
AA Change: D131G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079647
Gene: ENSMUSG00000098022
AA Change: D131G

DomainStartEndE-ValueType
KRAB 6 66 8.68e-33 SMART
ZnF_C2H2 168 190 1.1e-2 SMART
ZnF_C2H2 196 218 1.69e-3 SMART
ZnF_C2H2 224 246 1.79e-2 SMART
ZnF_C2H2 252 274 4.24e-4 SMART
ZnF_C2H2 280 300 5.2e0 SMART
ZnF_C2H2 308 330 7.05e-1 SMART
ZnF_C2H2 336 358 1.2e-3 SMART
ZnF_C2H2 364 386 3.63e-3 SMART
ZnF_C2H2 392 414 4.47e-3 SMART
ZnF_C2H2 420 442 1.79e-2 SMART
ZnF_C2H2 448 470 5.5e-3 SMART
ZnF_C2H2 476 498 5.9e-3 SMART
ZnF_C2H2 504 526 1.92e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182483
Predicted Effect probably benign
Transcript: ENSMUST00000182546
AA Change: D101G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138217
Gene: ENSMUSG00000098022
AA Change: D101G

DomainStartEndE-ValueType
KRAB 6 62 5.01e-15 SMART
ZnF_C2H2 138 160 1.1e-2 SMART
ZnF_C2H2 166 188 1.69e-3 SMART
ZnF_C2H2 194 216 1.79e-2 SMART
ZnF_C2H2 222 244 4.24e-4 SMART
ZnF_C2H2 250 270 5.2e0 SMART
ZnF_C2H2 278 300 7.05e-1 SMART
ZnF_C2H2 306 328 1.2e-3 SMART
ZnF_C2H2 334 356 3.63e-3 SMART
ZnF_C2H2 362 384 4.47e-3 SMART
ZnF_C2H2 390 412 1.79e-2 SMART
ZnF_C2H2 418 440 5.5e-3 SMART
ZnF_C2H2 446 468 5.9e-3 SMART
ZnF_C2H2 474 496 1.92e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182746
SMART Domains Protein: ENSMUSP00000138567
Gene: ENSMUSG00000058447

DomainStartEndE-ValueType
KRAB 6 56 1.44e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183025
Predicted Effect probably benign
Transcript: ENSMUST00000183115
AA Change: D37G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000183190
SMART Domains Protein: ENSMUSP00000138469
Gene: ENSMUSG00000098022

DomainStartEndE-ValueType
KRAB 6 66 8.68e-33 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Other mutations in Zfp82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Zfp82 APN 7 30066330 missense probably damaging 1.00
IGL03030:Zfp82 APN 7 30057465 missense probably benign 0.00
PIT4142001:Zfp82 UTSW 7 30057276 missense probably damaging 1.00
R0432:Zfp82 UTSW 7 30056329 missense probably damaging 1.00
R0513:Zfp82 UTSW 7 30056840 missense probably damaging 1.00
R0659:Zfp82 UTSW 7 30056329 missense probably damaging 1.00
R0959:Zfp82 UTSW 7 30056451 missense probably damaging 1.00
R1510:Zfp82 UTSW 7 30056622 missense probably damaging 1.00
R2198:Zfp82 UTSW 7 30057511 missense probably benign
R2892:Zfp82 UTSW 7 30056439 missense probably damaging 1.00
R4274:Zfp82 UTSW 7 30056367 missense probably damaging 0.99
R4932:Zfp82 UTSW 7 30056887 unclassified probably null
R5377:Zfp82 UTSW 7 30057166 missense probably damaging 1.00
R5677:Zfp82 UTSW 7 30057124 missense probably benign 0.43
R6822:Zfp82 UTSW 7 30056287 missense probably damaging 1.00
R7146:Zfp82 UTSW 7 30056167 missense probably benign
R7163:Zfp82 UTSW 7 30062244 missense probably benign
R7450:Zfp82 UTSW 7 30056895 missense probably damaging 1.00
R7476:Zfp82 UTSW 7 30056172 missense possibly damaging 0.69
R7627:Zfp82 UTSW 7 30056722 missense probably damaging 1.00
R7631:Zfp82 UTSW 7 30056426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGACATTAAGCTTCTGATGGCGAG -3'
(R):5'- ACTAAGGATGAGACCAACCAGGTGTTC -3'

Sequencing Primer
(F):5'- ccatcccacactccttacattc -3'
(R):5'- CAACCAGGTGTTCTCAGAAAATG -3'
Posted On2014-05-14