Incidental Mutation 'R1697:Klk1b1'
ID192328
Institutional Source Beutler Lab
Gene Symbol Klk1b1
Ensembl Gene ENSMUSG00000063133
Gene Namekallikrein 1-related peptidase b1
SynonymsmGK-1, tissue kallikrein, TK, Klk1, mK1
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1697 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43966751-43971318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43970326 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 103 (M103K)
Ref Sequence ENSEMBL: ENSMUSP00000077879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078835]
Predicted Effect probably benign
Transcript: ENSMUST00000078835
AA Change: M103K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000077879
Gene: ENSMUSG00000063133
AA Change: M103K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 1.25e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206796
Meta Mutation Damage Score 0.1294 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous null mice display decreased left ventricular contractility, cardiac output, and stroke volume, a thin left ventricular wall, and impaired vasodilation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Klk1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Klk1b1 APN 7 43971169 missense possibly damaging 0.83
IGL02794:Klk1b1 APN 7 43970365 missense possibly damaging 0.62
IGL03266:Klk1b1 APN 7 43970476 missense probably benign 0.18
R0324:Klk1b1 UTSW 7 43970741 nonsense probably null
R0689:Klk1b1 UTSW 7 43970719 missense probably benign
R1552:Klk1b1 UTSW 7 43969343 missense probably damaging 1.00
R1737:Klk1b1 UTSW 7 43970359 missense probably benign 0.01
R2060:Klk1b1 UTSW 7 43970623 missense possibly damaging 0.73
R2159:Klk1b1 UTSW 7 43970433 missense probably damaging 0.97
R2177:Klk1b1 UTSW 7 43969271 missense possibly damaging 0.63
R2213:Klk1b1 UTSW 7 43970481 missense probably damaging 1.00
R2509:Klk1b1 UTSW 7 43969379 missense probably damaging 1.00
R2510:Klk1b1 UTSW 7 43969379 missense probably damaging 1.00
R3849:Klk1b1 UTSW 7 43969327 missense probably damaging 1.00
R5567:Klk1b1 UTSW 7 43971169 missense probably damaging 0.99
R6191:Klk1b1 UTSW 7 43970657 missense probably damaging 1.00
R7162:Klk1b1 UTSW 7 43969247 missense probably damaging 0.99
R7535:Klk1b1 UTSW 7 43970322 missense probably damaging 1.00
X0012:Klk1b1 UTSW 7 43970659 missense probably benign 0.05
Z1088:Klk1b1 UTSW 7 43970401 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTACCTGCTGGGGAAGTACAGACC -3'
(R):5'- GCTTGGACCAGACTCACACTTGAC -3'

Sequencing Primer
(F):5'- GGAAGTACAGACCTGTCCTAGC -3'
(R):5'- TGACAGGTATAATGCTGCCC -3'
Posted On2014-05-14