Incidental Mutation 'R1697:Klk1b1'
ID 192328
Institutional Source Beutler Lab
Gene Symbol Klk1b1
Ensembl Gene ENSMUSG00000063133
Gene Name kallikrein 1-related peptidase b1
Synonyms mK1, tissue kallikrein, Klk1, TK, mGK-1
MMRRC Submission 039730-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R1697 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 43616175-43620742 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43619750 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 103 (M103K)
Ref Sequence ENSEMBL: ENSMUSP00000077879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078835]
AlphaFold P00755
Predicted Effect probably benign
Transcript: ENSMUST00000078835
AA Change: M103K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000077879
Gene: ENSMUSG00000063133
AA Change: M103K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 1.25e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206796
Meta Mutation Damage Score 0.1294 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous null mice display decreased left ventricular contractility, cardiac output, and stroke volume, a thin left ventricular wall, and impaired vasodilation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,992,928 (GRCm39) D250E probably damaging Het
4930571K23Rik A G 7: 124,968,201 (GRCm39) noncoding transcript Het
Acsl3 T C 1: 78,683,114 (GRCm39) probably benign Het
Acsl6 C A 11: 54,220,792 (GRCm39) T244K probably damaging Het
Adam26b T A 8: 43,974,000 (GRCm39) N334I probably damaging Het
Adgrl4 C T 3: 151,223,248 (GRCm39) T608M probably damaging Het
Aldh2 A G 5: 121,716,404 (GRCm39) probably null Het
Alms1 A G 6: 85,599,436 (GRCm39) T1890A possibly damaging Het
Capn7 C T 14: 31,082,117 (GRCm39) T441M probably damaging Het
Cd9 A T 6: 125,441,367 (GRCm39) C85S probably damaging Het
Chrm3 T C 13: 9,928,794 (GRCm39) T81A probably damaging Het
Ctif A G 18: 75,757,376 (GRCm39) probably benign Het
Dcc T A 18: 71,503,808 (GRCm39) D950V probably damaging Het
Eif4g1 T C 16: 20,498,530 (GRCm39) V422A probably damaging Het
Enthd1 A G 15: 80,337,124 (GRCm39) S437P probably damaging Het
Fads1 A G 19: 10,171,464 (GRCm39) probably benign Het
Fat3 T A 9: 15,856,176 (GRCm39) I3869L probably benign Het
Fbxw5 T A 2: 25,392,473 (GRCm39) V85E possibly damaging Het
Fcgbpl1 T A 7: 27,853,772 (GRCm39) C1579S probably damaging Het
Fem1b T C 9: 62,704,456 (GRCm39) D268G possibly damaging Het
Focad T C 4: 88,327,225 (GRCm39) L1772P probably damaging Het
Gtf3a C A 5: 146,888,723 (GRCm39) Q145K possibly damaging Het
Hacl1 T C 14: 31,342,957 (GRCm39) probably null Het
Herc2 T A 7: 55,803,653 (GRCm39) F2229L probably benign Het
Hs3st4 A T 7: 123,996,080 (GRCm39) I249L probably benign Het
Iqsec1 A T 6: 90,786,752 (GRCm39) Y7* probably null Het
Irag2 A G 6: 145,083,341 (GRCm39) probably benign Het
Krt5 A G 15: 101,619,020 (GRCm39) V287A probably benign Het
Lgals12 T A 19: 7,581,530 (GRCm39) Q59L possibly damaging Het
Loxl4 A G 19: 42,593,379 (GRCm39) V264A possibly damaging Het
Lrp1b T C 2: 40,712,695 (GRCm39) D3099G probably damaging Het
Mical3 G A 6: 120,984,369 (GRCm39) T169I possibly damaging Het
Muc21 A C 17: 35,931,540 (GRCm39) probably benign Het
Myef2l G A 3: 10,154,613 (GRCm39) V461I possibly damaging Het
Myh7b A C 2: 155,462,054 (GRCm39) S317R probably damaging Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Nsd1 A T 13: 55,361,872 (GRCm39) probably null Het
Nup58 A T 14: 60,482,119 (GRCm39) probably benign Het
Or1j17 C T 2: 36,578,259 (GRCm39) L82F probably damaging Het
Or2t49 A T 11: 58,392,502 (GRCm39) S293R probably damaging Het
Or5h22 A G 16: 58,895,270 (GRCm39) Y58H probably damaging Het
Or5i1 T A 2: 87,612,929 (GRCm39) I15N possibly damaging Het
Or6c2b T C 10: 128,947,737 (GRCm39) T186A probably benign Het
Pcnx2 A G 8: 126,577,087 (GRCm39) Y982H probably damaging Het
Pias3 T C 3: 96,609,541 (GRCm39) L312P probably damaging Het
Plekhm1 G A 11: 103,267,710 (GRCm39) P754S probably damaging Het
Ppp2r5c T A 12: 110,512,057 (GRCm39) L145* probably null Het
Ppp2r5c T A 12: 110,527,906 (GRCm39) probably benign Het
Pramel29 A C 4: 143,935,162 (GRCm39) I193S probably damaging Het
Proser3 T C 7: 30,239,446 (GRCm39) M553V probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Smurf2 A T 11: 106,715,514 (GRCm39) D664E possibly damaging Het
Spag9 G A 11: 93,887,391 (GRCm39) A99T probably benign Het
Stim1 T G 7: 102,003,713 (GRCm39) C49G probably damaging Het
Stk32c T C 7: 138,701,740 (GRCm39) I238V probably benign Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Tfb2m T A 1: 179,372,464 (GRCm39) E133V probably null Het
Tmem209 A T 6: 30,497,867 (GRCm39) C143S probably benign Het
Tnr T G 1: 159,679,600 (GRCm39) N191K probably benign Het
Vars1 C T 17: 35,217,198 (GRCm39) A419T probably benign Het
Vmn2r111 T C 17: 22,767,041 (GRCm39) S819G probably benign Het
Wls T C 3: 159,602,995 (GRCm39) V136A probably benign Het
Ybx2 C T 11: 69,830,887 (GRCm39) S217L probably benign Het
Zfp82 T C 7: 29,756,779 (GRCm39) D37G probably benign Het
Other mutations in Klk1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Klk1b1 APN 7 43,620,593 (GRCm39) missense possibly damaging 0.83
IGL02794:Klk1b1 APN 7 43,619,789 (GRCm39) missense possibly damaging 0.62
IGL03266:Klk1b1 APN 7 43,619,900 (GRCm39) missense probably benign 0.18
R0324:Klk1b1 UTSW 7 43,620,165 (GRCm39) nonsense probably null
R0689:Klk1b1 UTSW 7 43,620,143 (GRCm39) missense probably benign
R1552:Klk1b1 UTSW 7 43,618,767 (GRCm39) missense probably damaging 1.00
R1737:Klk1b1 UTSW 7 43,619,783 (GRCm39) missense probably benign 0.01
R2060:Klk1b1 UTSW 7 43,620,047 (GRCm39) missense possibly damaging 0.73
R2159:Klk1b1 UTSW 7 43,619,857 (GRCm39) missense probably damaging 0.97
R2177:Klk1b1 UTSW 7 43,618,695 (GRCm39) missense possibly damaging 0.63
R2213:Klk1b1 UTSW 7 43,619,905 (GRCm39) missense probably damaging 1.00
R2509:Klk1b1 UTSW 7 43,618,803 (GRCm39) missense probably damaging 1.00
R2510:Klk1b1 UTSW 7 43,618,803 (GRCm39) missense probably damaging 1.00
R3849:Klk1b1 UTSW 7 43,618,751 (GRCm39) missense probably damaging 1.00
R5567:Klk1b1 UTSW 7 43,620,593 (GRCm39) missense probably damaging 0.99
R6191:Klk1b1 UTSW 7 43,620,081 (GRCm39) missense probably damaging 1.00
R7162:Klk1b1 UTSW 7 43,618,671 (GRCm39) missense probably damaging 0.99
R7535:Klk1b1 UTSW 7 43,619,746 (GRCm39) missense probably damaging 1.00
R7752:Klk1b1 UTSW 7 43,620,669 (GRCm39) missense probably damaging 1.00
R7901:Klk1b1 UTSW 7 43,620,669 (GRCm39) missense probably damaging 1.00
R8320:Klk1b1 UTSW 7 43,619,767 (GRCm39) missense possibly damaging 0.86
R8379:Klk1b1 UTSW 7 43,619,767 (GRCm39) missense possibly damaging 0.86
R8381:Klk1b1 UTSW 7 43,619,767 (GRCm39) missense possibly damaging 0.86
R8383:Klk1b1 UTSW 7 43,619,767 (GRCm39) missense possibly damaging 0.86
R8511:Klk1b1 UTSW 7 43,619,767 (GRCm39) missense possibly damaging 0.86
R8867:Klk1b1 UTSW 7 43,619,747 (GRCm39) missense probably damaging 0.98
R9089:Klk1b1 UTSW 7 43,620,668 (GRCm39) missense possibly damaging 0.77
R9179:Klk1b1 UTSW 7 43,618,715 (GRCm39) missense probably damaging 1.00
R9761:Klk1b1 UTSW 7 43,618,739 (GRCm39) missense possibly damaging 0.79
X0012:Klk1b1 UTSW 7 43,620,083 (GRCm39) missense probably benign 0.05
Z1088:Klk1b1 UTSW 7 43,619,825 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTACCTGCTGGGGAAGTACAGACC -3'
(R):5'- GCTTGGACCAGACTCACACTTGAC -3'

Sequencing Primer
(F):5'- GGAAGTACAGACCTGTCCTAGC -3'
(R):5'- TGACAGGTATAATGCTGCCC -3'
Posted On 2014-05-14