Incidental Mutation 'R1697:Olfr769'
ID192340
Institutional Source Beutler Lab
Gene Symbol Olfr769
Ensembl Gene ENSMUSG00000042801
Gene Nameolfactory receptor 769
SynonymsGA_x6K02T2PULF-10797876-10796938, MOR114-14
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R1697 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129108952-129117861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129111868 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 186 (T186A)
Ref Sequence ENSEMBL: ENSMUSP00000149008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050915] [ENSMUST00000215453] [ENSMUST00000216906]
Predicted Effect probably benign
Transcript: ENSMUST00000050915
AA Change: T186A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000059078
Gene: ENSMUSG00000042801
AA Change: T186A

DomainStartEndE-ValueType
Pfam:7tm_4 29 309 1.2e-47 PFAM
Pfam:7tm_1 39 288 4.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215453
AA Change: T186A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000216906
AA Change: T186A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Olfr769
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Olfr769 APN 10 129112024 missense probably benign 0.01
IGL02556:Olfr769 APN 10 129112035 missense probably damaging 1.00
IGL02699:Olfr769 APN 10 129111771 missense probably benign 0.00
R0503:Olfr769 UTSW 10 129111802 missense probably damaging 0.98
R0677:Olfr769 UTSW 10 129112078 missense probably damaging 1.00
R2992:Olfr769 UTSW 10 129111535 nonsense probably null
R3922:Olfr769 UTSW 10 129111613 missense possibly damaging 0.78
R7084:Olfr769 UTSW 10 129111547 nonsense probably null
R7301:Olfr769 UTSW 10 129111699 missense probably damaging 1.00
R7488:Olfr769 UTSW 10 129111736 missense probably benign 0.03
RF021:Olfr769 UTSW 10 129112342 missense probably damaging 0.99
Z1177:Olfr769 UTSW 10 129111946 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACGTTGTGAGCACAGATACAACC -3'
(R):5'- AACCGAGTATGCACAGTTCTTGTCC -3'

Sequencing Primer
(F):5'- CTGCCATAGGTGATGGAAACC -3'
(R):5'- ATGCACAGTTCTTGTCCTCTCC -3'
Posted On2014-05-14