Incidental Mutation 'R1697:Acsl6'
ID 192342
Institutional Source Beutler Lab
Gene Symbol Acsl6
Ensembl Gene ENSMUSG00000020333
Gene Name acyl-CoA synthetase long-chain family member 6
Synonyms Lacsl, A330035H04Rik, Facl6
MMRRC Submission 039730-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.402) question?
Stock # R1697 (G1)
Quality Score 160
Status Validated
Chromosome 11
Chromosomal Location 54194624-54255582 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 54220792 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 244 (T244K)
Ref Sequence ENSEMBL: ENSMUSP00000119714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000145] [ENSMUST00000064690] [ENSMUST00000072178] [ENSMUST00000093106] [ENSMUST00000094194] [ENSMUST00000101211] [ENSMUST00000108905] [ENSMUST00000101213] [ENSMUST00000108904] [ENSMUST00000156252] [ENSMUST00000108899] [ENSMUST00000138515] [ENSMUST00000149403]
AlphaFold Q91WC3
Predicted Effect probably damaging
Transcript: ENSMUST00000000145
AA Change: T244K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000145
Gene: ENSMUSG00000020333
AA Change: T244K

DomainStartEndE-ValueType
Pfam:AMP-binding 68 273 7.7e-39 PFAM
Pfam:AMP-binding 262 488 2.7e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000064690
AA Change: T279K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069844
Gene: ENSMUSG00000020333
AA Change: T279K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 102 346 5.5e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072178
AA Change: T279K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072040
Gene: ENSMUSG00000020333
AA Change: T279K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093106
AA Change: T279K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090795
Gene: ENSMUSG00000020333
AA Change: T279K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094194
AA Change: T279K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091746
Gene: ENSMUSG00000020333
AA Change: T279K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101211
AA Change: T279K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098771
Gene: ENSMUSG00000020333
AA Change: T279K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 1.9e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108905
AA Change: T304K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104533
Gene: ENSMUSG00000020333
AA Change: T304K

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
Pfam:AMP-binding 128 588 7.7e-113 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101213
AA Change: T279K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098773
Gene: ENSMUSG00000020333
AA Change: T279K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 1.9e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108904
AA Change: T304K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104532
Gene: ENSMUSG00000020333
AA Change: T304K

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
Pfam:AMP-binding 128 588 1.6e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156252
AA Change: T244K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119714
Gene: ENSMUSG00000020333
AA Change: T244K

DomainStartEndE-ValueType
Pfam:AMP-binding 67 363 4.9e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108899
AA Change: T279K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104527
Gene: ENSMUSG00000020333
AA Change: T279K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 409 2.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138515
SMART Domains Protein: ENSMUSP00000117128
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 101 192 5.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149403
SMART Domains Protein: ENSMUSP00000120540
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SCOP:d1lci__ 82 139 2e-7 SMART
Meta Mutation Damage Score 0.9403 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of acyl-CoA from fatty acids, ATP, and CoA, using magnesium as a cofactor. The encoded protein plays a major role in fatty acid metabolism in the brain. Translocations with the ETV6 gene are causes of myelodysplastic syndrome with basophilia, acute myelogenous leukemia with eosinophilia, and acute eosinophilic leukemia. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,992,928 (GRCm39) D250E probably damaging Het
4930571K23Rik A G 7: 124,968,201 (GRCm39) noncoding transcript Het
Acsl3 T C 1: 78,683,114 (GRCm39) probably benign Het
Adam26b T A 8: 43,974,000 (GRCm39) N334I probably damaging Het
Adgrl4 C T 3: 151,223,248 (GRCm39) T608M probably damaging Het
Aldh2 A G 5: 121,716,404 (GRCm39) probably null Het
Alms1 A G 6: 85,599,436 (GRCm39) T1890A possibly damaging Het
Capn7 C T 14: 31,082,117 (GRCm39) T441M probably damaging Het
Cd9 A T 6: 125,441,367 (GRCm39) C85S probably damaging Het
Chrm3 T C 13: 9,928,794 (GRCm39) T81A probably damaging Het
Ctif A G 18: 75,757,376 (GRCm39) probably benign Het
Dcc T A 18: 71,503,808 (GRCm39) D950V probably damaging Het
Eif4g1 T C 16: 20,498,530 (GRCm39) V422A probably damaging Het
Enthd1 A G 15: 80,337,124 (GRCm39) S437P probably damaging Het
Fads1 A G 19: 10,171,464 (GRCm39) probably benign Het
Fat3 T A 9: 15,856,176 (GRCm39) I3869L probably benign Het
Fbxw5 T A 2: 25,392,473 (GRCm39) V85E possibly damaging Het
Fcgbpl1 T A 7: 27,853,772 (GRCm39) C1579S probably damaging Het
Fem1b T C 9: 62,704,456 (GRCm39) D268G possibly damaging Het
Focad T C 4: 88,327,225 (GRCm39) L1772P probably damaging Het
Gtf3a C A 5: 146,888,723 (GRCm39) Q145K possibly damaging Het
Hacl1 T C 14: 31,342,957 (GRCm39) probably null Het
Herc2 T A 7: 55,803,653 (GRCm39) F2229L probably benign Het
Hs3st4 A T 7: 123,996,080 (GRCm39) I249L probably benign Het
Iqsec1 A T 6: 90,786,752 (GRCm39) Y7* probably null Het
Irag2 A G 6: 145,083,341 (GRCm39) probably benign Het
Klk1b1 T A 7: 43,619,750 (GRCm39) M103K probably benign Het
Krt5 A G 15: 101,619,020 (GRCm39) V287A probably benign Het
Lgals12 T A 19: 7,581,530 (GRCm39) Q59L possibly damaging Het
Loxl4 A G 19: 42,593,379 (GRCm39) V264A possibly damaging Het
Lrp1b T C 2: 40,712,695 (GRCm39) D3099G probably damaging Het
Mical3 G A 6: 120,984,369 (GRCm39) T169I possibly damaging Het
Muc21 A C 17: 35,931,540 (GRCm39) probably benign Het
Myef2l G A 3: 10,154,613 (GRCm39) V461I possibly damaging Het
Myh7b A C 2: 155,462,054 (GRCm39) S317R probably damaging Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Nsd1 A T 13: 55,361,872 (GRCm39) probably null Het
Nup58 A T 14: 60,482,119 (GRCm39) probably benign Het
Or1j17 C T 2: 36,578,259 (GRCm39) L82F probably damaging Het
Or2t49 A T 11: 58,392,502 (GRCm39) S293R probably damaging Het
Or5h22 A G 16: 58,895,270 (GRCm39) Y58H probably damaging Het
Or5i1 T A 2: 87,612,929 (GRCm39) I15N possibly damaging Het
Or6c2b T C 10: 128,947,737 (GRCm39) T186A probably benign Het
Pcnx2 A G 8: 126,577,087 (GRCm39) Y982H probably damaging Het
Pias3 T C 3: 96,609,541 (GRCm39) L312P probably damaging Het
Plekhm1 G A 11: 103,267,710 (GRCm39) P754S probably damaging Het
Ppp2r5c T A 12: 110,512,057 (GRCm39) L145* probably null Het
Ppp2r5c T A 12: 110,527,906 (GRCm39) probably benign Het
Pramel29 A C 4: 143,935,162 (GRCm39) I193S probably damaging Het
Proser3 T C 7: 30,239,446 (GRCm39) M553V probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Smurf2 A T 11: 106,715,514 (GRCm39) D664E possibly damaging Het
Spag9 G A 11: 93,887,391 (GRCm39) A99T probably benign Het
Stim1 T G 7: 102,003,713 (GRCm39) C49G probably damaging Het
Stk32c T C 7: 138,701,740 (GRCm39) I238V probably benign Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Tfb2m T A 1: 179,372,464 (GRCm39) E133V probably null Het
Tmem209 A T 6: 30,497,867 (GRCm39) C143S probably benign Het
Tnr T G 1: 159,679,600 (GRCm39) N191K probably benign Het
Vars1 C T 17: 35,217,198 (GRCm39) A419T probably benign Het
Vmn2r111 T C 17: 22,767,041 (GRCm39) S819G probably benign Het
Wls T C 3: 159,602,995 (GRCm39) V136A probably benign Het
Ybx2 C T 11: 69,830,887 (GRCm39) S217L probably benign Het
Zfp82 T C 7: 29,756,779 (GRCm39) D37G probably benign Het
Other mutations in Acsl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Acsl6 APN 11 54,216,472 (GRCm39) missense probably damaging 1.00
IGL01374:Acsl6 APN 11 54,229,245 (GRCm39) missense probably damaging 1.00
IGL01455:Acsl6 APN 11 54,214,131 (GRCm39) missense possibly damaging 0.93
IGL01607:Acsl6 APN 11 54,243,823 (GRCm39) missense possibly damaging 0.94
IGL01731:Acsl6 APN 11 54,241,385 (GRCm39) missense probably benign 0.04
IGL01775:Acsl6 APN 11 54,236,826 (GRCm39) splice site probably benign
IGL02487:Acsl6 APN 11 54,227,769 (GRCm39) missense possibly damaging 0.76
IGL02716:Acsl6 APN 11 54,218,102 (GRCm39) missense probably benign 0.02
IGL02893:Acsl6 APN 11 54,236,725 (GRCm39) missense probably damaging 1.00
R0514:Acsl6 UTSW 11 54,241,406 (GRCm39) missense probably damaging 1.00
R0739:Acsl6 UTSW 11 54,227,961 (GRCm39) missense probably damaging 1.00
R1593:Acsl6 UTSW 11 54,214,134 (GRCm39) missense probably damaging 1.00
R1611:Acsl6 UTSW 11 54,216,390 (GRCm39) missense possibly damaging 0.93
R1626:Acsl6 UTSW 11 54,242,872 (GRCm39) missense probably damaging 1.00
R1633:Acsl6 UTSW 11 54,219,224 (GRCm39) splice site probably benign
R1852:Acsl6 UTSW 11 54,251,902 (GRCm39) missense probably damaging 1.00
R1923:Acsl6 UTSW 11 54,216,417 (GRCm39) missense probably damaging 1.00
R2081:Acsl6 UTSW 11 54,211,085 (GRCm39) missense possibly damaging 0.76
R2144:Acsl6 UTSW 11 54,232,604 (GRCm39) missense probably damaging 1.00
R2167:Acsl6 UTSW 11 54,217,983 (GRCm39) missense probably benign 0.03
R2205:Acsl6 UTSW 11 54,214,833 (GRCm39) missense probably damaging 1.00
R2357:Acsl6 UTSW 11 54,218,106 (GRCm39) missense probably damaging 0.99
R4288:Acsl6 UTSW 11 54,227,912 (GRCm39) missense probably benign 0.19
R4450:Acsl6 UTSW 11 54,219,229 (GRCm39) missense probably damaging 1.00
R4783:Acsl6 UTSW 11 54,227,819 (GRCm39) missense probably damaging 1.00
R5115:Acsl6 UTSW 11 54,231,324 (GRCm39) splice site probably null
R5233:Acsl6 UTSW 11 54,216,432 (GRCm39) missense possibly damaging 0.69
R5416:Acsl6 UTSW 11 54,227,997 (GRCm39) missense probably benign 0.00
R5482:Acsl6 UTSW 11 54,217,964 (GRCm39) missense probably damaging 1.00
R5633:Acsl6 UTSW 11 54,228,015 (GRCm39) missense probably benign
R5749:Acsl6 UTSW 11 54,214,881 (GRCm39) critical splice donor site probably null
R6139:Acsl6 UTSW 11 54,231,368 (GRCm39) missense probably damaging 1.00
R6270:Acsl6 UTSW 11 54,242,933 (GRCm39) missense probably benign 0.45
R6337:Acsl6 UTSW 11 54,231,368 (GRCm39) missense probably damaging 1.00
R6571:Acsl6 UTSW 11 54,216,390 (GRCm39) missense possibly damaging 0.85
R6736:Acsl6 UTSW 11 54,215,992 (GRCm39) missense probably damaging 1.00
R6918:Acsl6 UTSW 11 54,232,582 (GRCm39) splice site probably null
R6919:Acsl6 UTSW 11 54,232,582 (GRCm39) splice site probably null
R7846:Acsl6 UTSW 11 54,251,901 (GRCm39) missense probably damaging 0.98
R7910:Acsl6 UTSW 11 54,236,797 (GRCm39) nonsense probably null
R8330:Acsl6 UTSW 11 54,236,034 (GRCm39) missense probably benign 0.22
R8532:Acsl6 UTSW 11 54,218,001 (GRCm39) missense probably damaging 1.00
R8535:Acsl6 UTSW 11 54,229,328 (GRCm39) missense probably damaging 1.00
R8884:Acsl6 UTSW 11 54,236,728 (GRCm39) missense probably damaging 1.00
R9036:Acsl6 UTSW 11 54,227,840 (GRCm39) critical splice donor site probably null
R9052:Acsl6 UTSW 11 54,232,615 (GRCm39) missense possibly damaging 0.78
R9455:Acsl6 UTSW 11 54,210,752 (GRCm39) unclassified probably benign
R9514:Acsl6 UTSW 11 54,225,880 (GRCm39) missense probably benign 0.00
R9530:Acsl6 UTSW 11 54,220,783 (GRCm39) missense probably damaging 1.00
R9603:Acsl6 UTSW 11 54,225,911 (GRCm39) missense probably damaging 1.00
Z1177:Acsl6 UTSW 11 54,210,998 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACACAGAAGTGTGTAACATGCC -3'
(R):5'- GCACTAAGCACAGCCATTTATGCTC -3'

Sequencing Primer
(F):5'- GTGTGTAACATGCCCAACACATC -3'
(R):5'- TCCTGGTCTCTGACACAAAGG -3'
Posted On 2014-05-14