Incidental Mutation 'R1697:Acsl6'
ID192342
Institutional Source Beutler Lab
Gene Symbol Acsl6
Ensembl Gene ENSMUSG00000020333
Gene Nameacyl-CoA synthetase long-chain family member 6
SynonymsLacsl, Facl6, A330035H04Rik
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R1697 (G1)
Quality Score160
Status Validated
Chromosome11
Chromosomal Location54303798-54364756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 54329966 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 244 (T244K)
Ref Sequence ENSEMBL: ENSMUSP00000119714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000145] [ENSMUST00000064690] [ENSMUST00000072178] [ENSMUST00000093106] [ENSMUST00000094194] [ENSMUST00000101211] [ENSMUST00000101213] [ENSMUST00000108899] [ENSMUST00000108904] [ENSMUST00000108905] [ENSMUST00000138515] [ENSMUST00000149403] [ENSMUST00000156252]
Predicted Effect probably damaging
Transcript: ENSMUST00000000145
AA Change: T244K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000145
Gene: ENSMUSG00000020333
AA Change: T244K

DomainStartEndE-ValueType
Pfam:AMP-binding 68 273 7.7e-39 PFAM
Pfam:AMP-binding 262 488 2.7e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000064690
AA Change: T279K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069844
Gene: ENSMUSG00000020333
AA Change: T279K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 102 346 5.5e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072178
AA Change: T279K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072040
Gene: ENSMUSG00000020333
AA Change: T279K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093106
AA Change: T279K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090795
Gene: ENSMUSG00000020333
AA Change: T279K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094194
AA Change: T279K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091746
Gene: ENSMUSG00000020333
AA Change: T279K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101211
AA Change: T279K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098771
Gene: ENSMUSG00000020333
AA Change: T279K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 1.9e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101213
AA Change: T279K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098773
Gene: ENSMUSG00000020333
AA Change: T279K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 1.9e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108899
AA Change: T279K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104527
Gene: ENSMUSG00000020333
AA Change: T279K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 409 2.3e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108904
AA Change: T304K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104532
Gene: ENSMUSG00000020333
AA Change: T304K

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
Pfam:AMP-binding 128 588 1.6e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108905
AA Change: T304K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104533
Gene: ENSMUSG00000020333
AA Change: T304K

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
Pfam:AMP-binding 128 588 7.7e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138515
SMART Domains Protein: ENSMUSP00000117128
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 101 192 5.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149403
SMART Domains Protein: ENSMUSP00000120540
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SCOP:d1lci__ 82 139 2e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000156252
AA Change: T244K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119714
Gene: ENSMUSG00000020333
AA Change: T244K

DomainStartEndE-ValueType
Pfam:AMP-binding 67 363 4.9e-54 PFAM
Meta Mutation Damage Score 0.9403 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of acyl-CoA from fatty acids, ATP, and CoA, using magnesium as a cofactor. The encoded protein plays a major role in fatty acid metabolism in the brain. Translocations with the ETV6 gene are causes of myelodysplastic syndrome with basophilia, acute myelogenous leukemia with eosinophilia, and acute eosinophilic leukemia. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Acsl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Acsl6 APN 11 54325646 missense probably damaging 1.00
IGL01374:Acsl6 APN 11 54338419 missense probably damaging 1.00
IGL01455:Acsl6 APN 11 54323305 missense possibly damaging 0.93
IGL01607:Acsl6 APN 11 54352997 missense possibly damaging 0.94
IGL01731:Acsl6 APN 11 54350559 missense probably benign 0.04
IGL01775:Acsl6 APN 11 54346000 splice site probably benign
IGL02487:Acsl6 APN 11 54336943 missense possibly damaging 0.76
IGL02716:Acsl6 APN 11 54327276 missense probably benign 0.02
IGL02893:Acsl6 APN 11 54345899 missense probably damaging 1.00
R0514:Acsl6 UTSW 11 54350580 missense probably damaging 1.00
R0739:Acsl6 UTSW 11 54337135 missense probably damaging 1.00
R1593:Acsl6 UTSW 11 54323308 missense probably damaging 1.00
R1611:Acsl6 UTSW 11 54325564 missense possibly damaging 0.93
R1626:Acsl6 UTSW 11 54352046 missense probably damaging 1.00
R1633:Acsl6 UTSW 11 54328398 splice site probably benign
R1852:Acsl6 UTSW 11 54361076 missense probably damaging 1.00
R1923:Acsl6 UTSW 11 54325591 missense probably damaging 1.00
R2081:Acsl6 UTSW 11 54320259 missense possibly damaging 0.76
R2144:Acsl6 UTSW 11 54341778 missense probably damaging 1.00
R2167:Acsl6 UTSW 11 54327157 missense probably benign 0.03
R2205:Acsl6 UTSW 11 54324007 missense probably damaging 1.00
R2357:Acsl6 UTSW 11 54327280 missense probably damaging 0.99
R4288:Acsl6 UTSW 11 54337086 missense probably benign 0.19
R4450:Acsl6 UTSW 11 54328403 missense probably damaging 1.00
R4783:Acsl6 UTSW 11 54336993 missense probably damaging 1.00
R5115:Acsl6 UTSW 11 54340498 splice site probably null
R5233:Acsl6 UTSW 11 54325606 missense possibly damaging 0.69
R5416:Acsl6 UTSW 11 54337171 missense probably benign 0.00
R5482:Acsl6 UTSW 11 54327138 missense probably damaging 1.00
R5633:Acsl6 UTSW 11 54337189 missense probably benign
R5749:Acsl6 UTSW 11 54324055 critical splice donor site probably null
R6139:Acsl6 UTSW 11 54340542 missense probably damaging 1.00
R6270:Acsl6 UTSW 11 54352107 missense probably benign 0.45
R6337:Acsl6 UTSW 11 54340542 missense probably damaging 1.00
R6571:Acsl6 UTSW 11 54325564 missense possibly damaging 0.85
R6736:Acsl6 UTSW 11 54325166 missense probably damaging 1.00
R6918:Acsl6 UTSW 11 54341756 splice site probably null
R6919:Acsl6 UTSW 11 54341756 splice site probably null
R7846:Acsl6 UTSW 11 54361075 missense probably damaging 0.98
R7910:Acsl6 UTSW 11 54345971 nonsense probably null
R8330:Acsl6 UTSW 11 54345208 missense probably benign 0.22
R8532:Acsl6 UTSW 11 54327175 missense probably damaging 1.00
R8535:Acsl6 UTSW 11 54338502 missense probably damaging 1.00
R8884:Acsl6 UTSW 11 54345902 missense probably damaging 1.00
Z1177:Acsl6 UTSW 11 54320172 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACACAGAAGTGTGTAACATGCC -3'
(R):5'- GCACTAAGCACAGCCATTTATGCTC -3'

Sequencing Primer
(F):5'- GTGTGTAACATGCCCAACACATC -3'
(R):5'- TCCTGGTCTCTGACACAAAGG -3'
Posted On2014-05-14