Mutagenetix > Incidental Mutation

Incidental Mutation 'R1697:Plekhm1'

192347

Institutional Source

Beutler Lab

Gene Symbol

Plekhm1

Ensembl Gene

ENSMUSG00000034247

Gene Name

pleckstrin homology domain containing, family M (with RUN domain) member 1

Synonyms

B2, D330036J23Rik, AP162

MMRRC Submission

039730-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1697 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103364275-103412687 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 103376884 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 754 (P754S)

Ref Sequence

ENSEMBL: ENSMUSP00000047327 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041272]

AlphaFold

Q7TSI1

Predicted Effect

probably damaging
Transcript: ENSMUST00000041272
AA Change: P754S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000047327
Gene: ENSMUSG00000034247
AA Change: P754S

Domain	Start	End	E-Value	Type
RUN	117	180	3.36e-20	SMART
low complexity region	246	273	N/A	INTRINSIC
low complexity region	336	350	N/A	INTRINSIC
low complexity region	361	373	N/A	INTRINSIC
Blast:DUF4206	448	543	2e-11	BLAST
PH	552	644	2.16e-9	SMART
low complexity region	658	674	N/A	INTRINSIC
PH	702	797	2.15e-4	SMART
DUF4206	864	1068	7.51e-103	SMART
C1	1005	1058	2.72e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184350

Meta Mutation Damage Score

0.1102

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is essential for bone resorption, and may play a critical role in vesicular transport in the osteoclast. Mutations in this gene are associated with autosomal recessive osteopetrosis type 6 (OPTB6). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased trabecular bone mass and decreased bone resorption capacity of osteoclasts caused by defects in the peripheral positioning and secretion of lysosomes. Mice homozygous for a gene trap insertion do not exhibit any detectable phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930486L24Rik	A	T	13: 60,845,114	D250E	probably damaging	Het
4930571K23Rik	A	G	7: 125,369,029		noncoding transcript	Het
9530053A07Rik	T	A	7: 28,154,347	C1579S	probably damaging	Het
Acsl3	T	C	1: 78,705,397		probably benign	Het
Acsl6	C	A	11: 54,329,966	T244K	probably damaging	Het
Adam26b	T	A	8: 43,520,963	N334I	probably damaging	Het
Adgrl4	C	T	3: 151,517,611	T608M	probably damaging	Het
Aldh2	A	G	5: 121,578,341		probably null	Het
Alms1	A	G	6: 85,622,454	T1890A	possibly damaging	Het
C87977	A	C	4: 144,208,592	I193S	probably damaging	Het
Capn7	C	T	14: 31,360,160	T441M	probably damaging	Het
Cd9	A	T	6: 125,464,404	C85S	probably damaging	Het
Chrm3	T	C	13: 9,878,758	T81A	probably damaging	Het
Ctif	A	G	18: 75,624,305		probably benign	Het
Dcc	T	A	18: 71,370,737	D950V	probably damaging	Het
Eif4g1	T	C	16: 20,679,780	V422A	probably damaging	Het
Enthd1	A	G	15: 80,452,923	S437P	probably damaging	Het
Fads1	A	G	19: 10,194,100		probably benign	Het
Fat3	T	A	9: 15,944,880	I3869L	probably benign	Het
Fbxw5	T	A	2: 25,502,461	V85E	possibly damaging	Het
Fem1b	T	C	9: 62,797,174	D268G	possibly damaging	Het
Focad	T	C	4: 88,408,988	L1772P	probably damaging	Het
Gm9573	A	C	17: 35,620,648		probably benign	Het
Gm9833	G	A	3: 10,089,553	V461I	possibly damaging	Het
Gtf3a	C	A	5: 146,951,913	Q145K	possibly damaging	Het
Hacl1	T	C	14: 31,621,000		probably null	Het
Herc2	T	A	7: 56,153,905	F2229L	probably benign	Het
Hs3st4	A	T	7: 124,396,857	I249L	probably benign	Het
Iqsec1	A	T	6: 90,809,770	Y7*	probably null	Het
Klk1b1	T	A	7: 43,970,326	M103K	probably benign	Het
Krt5	A	G	15: 101,710,585	V287A	probably benign	Het
Lgals12	T	A	19: 7,604,165	Q59L	possibly damaging	Het
Loxl4	A	G	19: 42,604,940	V264A	possibly damaging	Het
Lrmp	A	G	6: 145,137,615		probably benign	Het
Lrp1b	T	C	2: 40,822,683	D3099G	probably damaging	Het
Mical3	G	A	6: 121,007,408	T169I	possibly damaging	Het
Myh7b	A	C	2: 155,620,134	S317R	probably damaging	Het
Nrbp1	T	A	5: 31,245,813	I210N	probably damaging	Het
Nsd1	A	T	13: 55,214,059		probably null	Het
Nupl1	A	T	14: 60,244,670		probably benign	Het
Olfr152	T	A	2: 87,782,585	I15N	possibly damaging	Het
Olfr190	A	G	16: 59,074,907	Y58H	probably damaging	Het
Olfr331	A	T	11: 58,501,676	S293R	probably damaging	Het
Olfr346	C	T	2: 36,688,247	L82F	probably damaging	Het
Olfr769	T	C	10: 129,111,868	T186A	probably benign	Het
Pcnx2	A	G	8: 125,850,348	Y982H	probably damaging	Het
Pias3	T	C	3: 96,702,225	L312P	probably damaging	Het
Ppp2r5c	T	A	12: 110,545,623	L145*	probably null	Het
Ppp2r5c	T	A	12: 110,561,472		probably benign	Het
Proser3	T	C	7: 30,540,021	M553V	probably benign	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Smurf2	A	T	11: 106,824,688	D664E	possibly damaging	Het
Spag9	G	A	11: 93,996,565	A99T	probably benign	Het
Stim1	T	G	7: 102,354,506	C49G	probably damaging	Het
Stk32c	T	C	7: 139,121,824	I238V	probably benign	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Tfb2m	T	A	1: 179,544,899	E133V	probably null	Het
Tmem209	A	T	6: 30,497,868	C143S	probably benign	Het
Tnr	T	G	1: 159,852,030	N191K	probably benign	Het
Vars	C	T	17: 34,998,222	A419T	probably benign	Het
Vmn2r111	T	C	17: 22,548,060	S819G	probably benign	Het
Wls	T	C	3: 159,897,358	V136A	probably benign	Het
Ybx2	C	T	11: 69,940,061	S217L	probably benign	Het
Zfp82	T	C	7: 30,057,354	D37G	probably benign	Het

Other mutations in Plekhm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01517:Plekhm1	APN	11	103394783	missense	possibly damaging	0.54
IGL01876:Plekhm1	APN	11	103376751	missense	probably damaging	1.00
IGL02159:Plekhm1	APN	11	103380231	missense	probably benign	0.04
IGL02404:Plekhm1	APN	11	103394998	missense	probably benign	0.18
IGL02537:Plekhm1	APN	11	103397192	missense	probably damaging	1.00
IGL02568:Plekhm1	APN	11	103395050	missense	probably damaging	1.00
IGL02660:Plekhm1	APN	11	103374094	splice site	probably benign
IGL03130:Plekhm1	APN	11	103377381	missense	probably benign	0.17
IGL03208:Plekhm1	APN	11	103376770	missense	probably benign	0.00
R0442:Plekhm1	UTSW	11	103397174	missense	possibly damaging	0.45
R0491:Plekhm1	UTSW	11	103394776	missense	probably benign	0.05
R0520:Plekhm1	UTSW	11	103394944	missense	probably benign	0.17
R0964:Plekhm1	UTSW	11	103395082	nonsense	probably null
R1189:Plekhm1	UTSW	11	103387062	missense	probably benign	0.00
R1501:Plekhm1	UTSW	11	103387062	missense	probably benign	0.00
R1781:Plekhm1	UTSW	11	103394856	missense	probably damaging	1.00
R1873:Plekhm1	UTSW	11	103373998	missense	probably benign	0.01
R2087:Plekhm1	UTSW	11	103397025	critical splice donor site	probably null
R2215:Plekhm1	UTSW	11	103376985	missense	probably damaging	1.00
R2271:Plekhm1	UTSW	11	103387122	missense	probably benign	0.00
R4256:Plekhm1	UTSW	11	103370934	missense	probably damaging	0.98
R4393:Plekhm1	UTSW	11	103376965	missense	possibly damaging	0.51
R4526:Plekhm1	UTSW	11	103395304	missense	probably damaging	0.97
R5119:Plekhm1	UTSW	11	103387315	missense	possibly damaging	0.62
R5975:Plekhm1	UTSW	11	103376691	missense	possibly damaging	0.49
R6389:Plekhm1	UTSW	11	103366894	missense	probably benign	0.21
R6454:Plekhm1	UTSW	11	103377382	missense	probably damaging	1.00
R6755:Plekhm1	UTSW	11	103387243	missense	possibly damaging	0.65
R6830:Plekhm1	UTSW	11	103376889	missense	probably damaging	0.97
R7039:Plekhm1	UTSW	11	103395228	missense	probably damaging	1.00
R7066:Plekhm1	UTSW	11	103370988	missense	possibly damaging	0.47
R7149:Plekhm1	UTSW	11	103394916	missense	probably damaging	0.98
R7349:Plekhm1	UTSW	11	103387334	missense	probably damaging	0.98
R7505:Plekhm1	UTSW	11	103380029	splice site	probably null
R7792:Plekhm1	UTSW	11	103397060	missense	probably damaging	0.99
R7867:Plekhm1	UTSW	11	103380327	missense	probably damaging	1.00
R8124:Plekhm1	UTSW	11	103366949	missense	probably benign	0.02
R8194:Plekhm1	UTSW	11	103395060	missense	possibly damaging	0.68
R8725:Plekhm1	UTSW	11	103367618	missense	probably damaging	1.00
R8727:Plekhm1	UTSW	11	103367618	missense	probably damaging	1.00
R8734:Plekhm1	UTSW	11	103394952	missense	probably damaging	1.00
R8927:Plekhm1	UTSW	11	103377213	missense	probably benign	0.04
R8928:Plekhm1	UTSW	11	103377213	missense	probably benign	0.04
R9681:Plekhm1	UTSW	11	103368124	missense	possibly damaging	0.82
X0058:Plekhm1	UTSW	11	103377366	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTGGTAGCAAACTTCAGCACCTCC -3'
(R):5'- TGAATATCCAGTACCCAGACCAGGC -3'

Sequencing Primer
(F):5'- TTTTCATCCAGACTCCCACCAAG -3'
(R):5'- CATGCAGTTGGACTGGACATC -3'

Posted On

2014-05-14