Incidental Mutation 'R1697:Ppp2r5c'
ID192350
Institutional Source Beutler Lab
Gene Symbol Ppp2r5c
Ensembl Gene ENSMUSG00000017843
Gene Nameprotein phosphatase 2, regulatory subunit B', gamma
Synonyms2700063L20Rik, 2610043M05Rik, Band 8A, D12Bwg0916e, B56/PP2A gamma
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1697 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location110447120-110583062 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 110561472 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084985] [ENSMUST00000109832] [ENSMUST00000221074] [ENSMUST00000221715]
AlphaFold Q60996
Predicted Effect probably benign
Transcript: ENSMUST00000084985
SMART Domains Protein: ENSMUSP00000082053
Gene: ENSMUSG00000017843

DomainStartEndE-ValueType
Pfam:B56 27 437 1.6e-199 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109832
SMART Domains Protein: ENSMUSP00000105458
Gene: ENSMUSG00000017843

DomainStartEndE-ValueType
Pfam:B56 26 438 3e-178 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221074
Predicted Effect probably benign
Transcript: ENSMUST00000221715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223168
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele show partial neonatal lethality, hypoactivity, and abnormal ventricular septum formation associated with increased fetal cardiomyocyte apoptosis. Surviving homozygotes develop obesity and show an abnormal gait, decreased grip strength, and impaired balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Ppp2r5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Ppp2r5c APN 12 110567827 missense probably benign 0.09
IGL01743:Ppp2r5c APN 12 110580434 missense probably benign 0.00
IGL01866:Ppp2r5c APN 12 110567827 missense probably benign 0.24
IGL02883:Ppp2r5c APN 12 110522563 missense possibly damaging 0.48
IGL02944:Ppp2r5c APN 12 110567800 missense probably benign 0.02
Abscond UTSW 12 110544077 missense probably benign 0.02
Cranraisin UTSW 12 110544145 missense probably damaging 1.00
elope UTSW 12 110561472 splice site probably benign
FR4976:Ppp2r5c UTSW 12 110540738 splice site probably null
R0020:Ppp2r5c UTSW 12 110574823 nonsense probably null
R0069:Ppp2r5c UTSW 12 110567770 missense probably benign 0.01
R0069:Ppp2r5c UTSW 12 110567770 missense probably benign 0.01
R0456:Ppp2r5c UTSW 12 110522579 missense probably damaging 0.99
R1521:Ppp2r5c UTSW 12 110554886 missense probably damaging 1.00
R1697:Ppp2r5c UTSW 12 110545623 nonsense probably null
R2248:Ppp2r5c UTSW 12 110485923 missense probably benign 0.00
R3817:Ppp2r5c UTSW 12 110544187 critical splice donor site probably null
R4491:Ppp2r5c UTSW 12 110580522 missense possibly damaging 0.69
R5575:Ppp2r5c UTSW 12 110552832 missense probably damaging 1.00
R5828:Ppp2r5c UTSW 12 110570700 missense probably benign 0.01
R6059:Ppp2r5c UTSW 12 110574788 missense probably benign
R6351:Ppp2r5c UTSW 12 110554879 missense probably damaging 1.00
R6807:Ppp2r5c UTSW 12 110569022 missense possibly damaging 0.80
R6976:Ppp2r5c UTSW 12 110544145 missense probably damaging 1.00
R7236:Ppp2r5c UTSW 12 110465889 missense probably benign 0.01
R7360:Ppp2r5c UTSW 12 110574838 missense probably benign
R7363:Ppp2r5c UTSW 12 110522607 missense probably benign 0.01
R7467:Ppp2r5c UTSW 12 110552883 missense probably damaging 1.00
R7948:Ppp2r5c UTSW 12 110465986 missense probably benign
R8117:Ppp2r5c UTSW 12 110551085 missense possibly damaging 0.47
R8310:Ppp2r5c UTSW 12 110545825 missense possibly damaging 0.95
R8352:Ppp2r5c UTSW 12 110544077 missense probably benign 0.02
R8452:Ppp2r5c UTSW 12 110544077 missense probably benign 0.02
R8692:Ppp2r5c UTSW 12 110522598 missense probably benign 0.00
R8858:Ppp2r5c UTSW 12 110552895 critical splice donor site probably null
R9108:Ppp2r5c UTSW 12 110554869 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTAATGGCACTTCTCAAATACTGGC -3'
(R):5'- GAGTGGTTTCAGTGAGCAGCATAGG -3'

Sequencing Primer
(F):5'- GGCCAAAGACTCACAGTCC -3'
(R):5'- gtctcaatttgtagcaatcctcc -3'
Posted On2014-05-14