Incidental Mutation 'R1697:Nupl1'
ID192357
Institutional Source Beutler Lab
Gene Symbol Nupl1
Ensembl Gene ENSMUSG00000063895
Gene Namenucleoporin like 1
Synonyms1700017F11Rik
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R1697 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location60184612-60251431 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 60244670 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041905] [ENSMUST00000225111] [ENSMUST00000225311] [ENSMUST00000225805]
Predicted Effect probably benign
Transcript: ENSMUST00000041905
SMART Domains Protein: ENSMUSP00000038716
Gene: ENSMUSG00000114797

DomainStartEndE-ValueType
Pfam:Nucleoporin_FG2 3 587 1.5e-299 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224575
Predicted Effect probably benign
Transcript: ENSMUST00000225111
Predicted Effect probably benign
Transcript: ENSMUST00000225311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225572
Predicted Effect probably benign
Transcript: ENSMUST00000225805
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleoporin family that shares 87% sequence identity with rat nucleoporin p58. The protein is localized to the nuclear rim and is a component of the nuclear pore complex (NPC). All molecules entering or leaving the nucleus either diffuse through or are actively transported by the NPC. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Nupl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Nupl1 APN 14 60242577 missense probably benign 0.01
IGL00693:Nupl1 APN 14 60238520 missense probably benign 0.10
IGL00725:Nupl1 APN 14 60243440 missense possibly damaging 0.84
IGL00969:Nupl1 APN 14 60228916 splice site probably benign
IGL03243:Nupl1 APN 14 60221616 missense probably benign 0.06
IGL03351:Nupl1 APN 14 60228775 missense probably benign 0.19
R0056:Nupl1 UTSW 14 60239475 splice site probably null
R0113:Nupl1 UTSW 14 60251291 start gained probably benign
R0201:Nupl1 UTSW 14 60244616 missense probably benign 0.32
R0830:Nupl1 UTSW 14 60243482 missense probably damaging 1.00
R0925:Nupl1 UTSW 14 60220141 missense probably damaging 0.99
R1004:Nupl1 UTSW 14 60247481 splice site probably benign
R1178:Nupl1 UTSW 14 60244670 splice site probably benign
R1181:Nupl1 UTSW 14 60244670 splice site probably benign
R1268:Nupl1 UTSW 14 60244670 splice site probably benign
R1388:Nupl1 UTSW 14 60244670 splice site probably benign
R1411:Nupl1 UTSW 14 60244670 splice site probably benign
R1442:Nupl1 UTSW 14 60232543 splice site probably benign
R1626:Nupl1 UTSW 14 60242627 nonsense probably null
R1756:Nupl1 UTSW 14 60244670 splice site probably benign
R1853:Nupl1 UTSW 14 60244547 missense possibly damaging 0.81
R1915:Nupl1 UTSW 14 60238531 missense probably benign 0.00
R2160:Nupl1 UTSW 14 60239508 missense probably benign 0.15
R2211:Nupl1 UTSW 14 60232640 missense probably damaging 0.99
R2213:Nupl1 UTSW 14 60239496 missense probably benign 0.01
R2518:Nupl1 UTSW 14 60232660 missense probably damaging 1.00
R2519:Nupl1 UTSW 14 60223359 missense probably benign 0.23
R3914:Nupl1 UTSW 14 60232147 missense possibly damaging 0.76
R4302:Nupl1 UTSW 14 60247426 missense probably benign 0.44
R4626:Nupl1 UTSW 14 60238555 missense probably benign 0.24
R4705:Nupl1 UTSW 14 60251215 missense unknown
R4772:Nupl1 UTSW 14 60220022 missense probably benign 0.00
R6151:Nupl1 UTSW 14 60244616 missense possibly damaging 0.71
R6187:Nupl1 UTSW 14 60240807 splice site probably null
R6546:Nupl1 UTSW 14 60223223 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTGTCTCACCTGCTGGAGTTGATG -3'
(R):5'- GGGAATAAGTGCTACTGTACGAAAGCC -3'

Sequencing Primer
(F):5'- TGTCAGAGCAGATGAGAGAGTAAG -3'
(R):5'- gcttagcattcagagattgcc -3'
Posted On2014-05-14