Incidental Mutation 'R1697:Krt5'
ID192359
Institutional Source Beutler Lab
Gene Symbol Krt5
Ensembl Gene ENSMUSG00000061527
Gene Namekeratin 5
SynonymsKrt2-5, Tfip8, 3300001P10Rik, K5
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1697 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101707070-101712898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101710585 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 287 (V287A)
Ref Sequence ENSEMBL: ENSMUSP00000023709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023709]
Predicted Effect probably benign
Transcript: ENSMUST00000023709
AA Change: V287A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000023709
Gene: ENSMUSG00000061527
AA Change: V287A

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 158 3.6e-44 PFAM
Filament 161 474 1.58e-174 SMART
low complexity region 483 577 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198689
Meta Mutation Damage Score 0.2226 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the basal layer of the epidermis with family member KRT14. Mutations in these genes have been associated with a complex of diseases termed epidermolysis bullosa simplex. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within the first hour after birth. They have a loose, fragile epidermal layer and abnormal epithelium in parts of the digestive tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Krt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Krt5 APN 15 101712641 missense unknown
IGL01949:Krt5 APN 15 101710613 missense probably benign 0.14
IGL03013:Krt5 APN 15 101711668 missense probably benign 0.00
IGL03286:Krt5 APN 15 101707548 missense unknown
R1598:Krt5 UTSW 15 101712441 missense probably benign 0.38
R1967:Krt5 UTSW 15 101711659 missense probably benign 0.21
R2143:Krt5 UTSW 15 101712359 missense probably damaging 1.00
R2438:Krt5 UTSW 15 101711658 missense probably benign 0.10
R4633:Krt5 UTSW 15 101711607 missense probably damaging 0.98
R4771:Krt5 UTSW 15 101709059 missense probably damaging 0.99
R4918:Krt5 UTSW 15 101710307 missense probably damaging 1.00
R5622:Krt5 UTSW 15 101709035 missense probably damaging 1.00
R6797:Krt5 UTSW 15 101712641 missense unknown
R6873:Krt5 UTSW 15 101712877 start gained probably benign
R7808:Krt5 UTSW 15 101709018 missense probably benign 0.01
R8010:Krt5 UTSW 15 101712356 missense probably damaging 1.00
R8252:Krt5 UTSW 15 101712359 missense probably damaging 1.00
R8696:Krt5 UTSW 15 101710307 missense probably damaging 1.00
R8889:Krt5 UTSW 15 101710750 missense probably benign 0.01
R8892:Krt5 UTSW 15 101710750 missense probably benign 0.01
X0019:Krt5 UTSW 15 101712368 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGACCTCAGCGATGATGCTGTCC -3'
(R):5'- GCTCACAGTGACTGCACAGATACC -3'

Sequencing Primer
(F):5'- ATGATGCTGTCCAGGTCCAG -3'
(R):5'- CCTTTGACCACCAGGTATGAG -3'
Posted On2014-05-14