Mutagenetix > Incidental Mutation

Incidental Mutation 'R1697:Krt5'

192359

Institutional Source

Beutler Lab

Gene Symbol

Krt5

Ensembl Gene

ENSMUSG00000061527

Gene Name

keratin 5

Synonyms

Krt2-5, Tfip8, 3300001P10Rik, K5

MMRRC Submission

039730-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1697 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101707070-101712898 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101710585 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 287 (V287A)

Ref Sequence

ENSEMBL: ENSMUSP00000023709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023709]

AlphaFold

Q922U2

Predicted Effect

probably benign
Transcript: ENSMUST00000023709
AA Change: V287A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000023709
Gene: ENSMUSG00000061527
AA Change: V287A

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	16	158	3.6e-44	PFAM
Filament	161	474	1.58e-174	SMART
low complexity region	483	577	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198689

Meta Mutation Damage Score

0.2226

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the basal layer of the epidermis with family member KRT14. Mutations in these genes have been associated with a complex of diseases termed epidermolysis bullosa simplex. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within the first hour after birth. They have a loose, fragile epidermal layer and abnormal epithelium in parts of the digestive tract. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930486L24Rik	A	T	13: 60,845,114	D250E	probably damaging	Het
4930571K23Rik	A	G	7: 125,369,029		noncoding transcript	Het
9530053A07Rik	T	A	7: 28,154,347	C1579S	probably damaging	Het
Acsl3	T	C	1: 78,705,397		probably benign	Het
Acsl6	C	A	11: 54,329,966	T244K	probably damaging	Het
Adam26b	T	A	8: 43,520,963	N334I	probably damaging	Het
Adgrl4	C	T	3: 151,517,611	T608M	probably damaging	Het
Aldh2	A	G	5: 121,578,341		probably null	Het
Alms1	A	G	6: 85,622,454	T1890A	possibly damaging	Het
C87977	A	C	4: 144,208,592	I193S	probably damaging	Het
Capn7	C	T	14: 31,360,160	T441M	probably damaging	Het
Cd9	A	T	6: 125,464,404	C85S	probably damaging	Het
Chrm3	T	C	13: 9,878,758	T81A	probably damaging	Het
Ctif	A	G	18: 75,624,305		probably benign	Het
Dcc	T	A	18: 71,370,737	D950V	probably damaging	Het
Eif4g1	T	C	16: 20,679,780	V422A	probably damaging	Het
Enthd1	A	G	15: 80,452,923	S437P	probably damaging	Het
Fads1	A	G	19: 10,194,100		probably benign	Het
Fat3	T	A	9: 15,944,880	I3869L	probably benign	Het
Fbxw5	T	A	2: 25,502,461	V85E	possibly damaging	Het
Fem1b	T	C	9: 62,797,174	D268G	possibly damaging	Het
Focad	T	C	4: 88,408,988	L1772P	probably damaging	Het
Gm9573	A	C	17: 35,620,648		probably benign	Het
Gm9833	G	A	3: 10,089,553	V461I	possibly damaging	Het
Gtf3a	C	A	5: 146,951,913	Q145K	possibly damaging	Het
Hacl1	T	C	14: 31,621,000		probably null	Het
Herc2	T	A	7: 56,153,905	F2229L	probably benign	Het
Hs3st4	A	T	7: 124,396,857	I249L	probably benign	Het
Iqsec1	A	T	6: 90,809,770	Y7*	probably null	Het
Klk1b1	T	A	7: 43,970,326	M103K	probably benign	Het
Lgals12	T	A	19: 7,604,165	Q59L	possibly damaging	Het
Loxl4	A	G	19: 42,604,940	V264A	possibly damaging	Het
Lrmp	A	G	6: 145,137,615		probably benign	Het
Lrp1b	T	C	2: 40,822,683	D3099G	probably damaging	Het
Mical3	G	A	6: 121,007,408	T169I	possibly damaging	Het
Myh7b	A	C	2: 155,620,134	S317R	probably damaging	Het
Nrbp1	T	A	5: 31,245,813	I210N	probably damaging	Het
Nsd1	A	T	13: 55,214,059		probably null	Het
Nupl1	A	T	14: 60,244,670		probably benign	Het
Olfr152	T	A	2: 87,782,585	I15N	possibly damaging	Het
Olfr190	A	G	16: 59,074,907	Y58H	probably damaging	Het
Olfr331	A	T	11: 58,501,676	S293R	probably damaging	Het
Olfr346	C	T	2: 36,688,247	L82F	probably damaging	Het
Olfr769	T	C	10: 129,111,868	T186A	probably benign	Het
Pcnx2	A	G	8: 125,850,348	Y982H	probably damaging	Het
Pias3	T	C	3: 96,702,225	L312P	probably damaging	Het
Plekhm1	G	A	11: 103,376,884	P754S	probably damaging	Het
Ppp2r5c	T	A	12: 110,545,623	L145*	probably null	Het
Ppp2r5c	T	A	12: 110,561,472		probably benign	Het
Proser3	T	C	7: 30,540,021	M553V	probably benign	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Smurf2	A	T	11: 106,824,688	D664E	possibly damaging	Het
Spag9	G	A	11: 93,996,565	A99T	probably benign	Het
Stim1	T	G	7: 102,354,506	C49G	probably damaging	Het
Stk32c	T	C	7: 139,121,824	I238V	probably benign	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Tfb2m	T	A	1: 179,544,899	E133V	probably null	Het
Tmem209	A	T	6: 30,497,868	C143S	probably benign	Het
Tnr	T	G	1: 159,852,030	N191K	probably benign	Het
Vars	C	T	17: 34,998,222	A419T	probably benign	Het
Vmn2r111	T	C	17: 22,548,060	S819G	probably benign	Het
Wls	T	C	3: 159,897,358	V136A	probably benign	Het
Ybx2	C	T	11: 69,940,061	S217L	probably benign	Het
Zfp82	T	C	7: 30,057,354	D37G	probably benign	Het

Other mutations in Krt5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00475:Krt5	APN	15	101712641	missense	unknown
IGL01949:Krt5	APN	15	101710613	missense	probably benign	0.14
IGL03013:Krt5	APN	15	101711668	missense	probably benign	0.00
IGL03286:Krt5	APN	15	101707548	missense	unknown
R1598:Krt5	UTSW	15	101712441	missense	probably benign	0.38
R1967:Krt5	UTSW	15	101711659	missense	probably benign	0.21
R2143:Krt5	UTSW	15	101712359	missense	probably damaging	1.00
R2438:Krt5	UTSW	15	101711658	missense	probably benign	0.10
R4633:Krt5	UTSW	15	101711607	missense	probably damaging	0.98
R4771:Krt5	UTSW	15	101709059	missense	probably damaging	0.99
R4918:Krt5	UTSW	15	101710307	missense	probably damaging	1.00
R5622:Krt5	UTSW	15	101709035	missense	probably damaging	1.00
R6797:Krt5	UTSW	15	101712641	missense	unknown
R6873:Krt5	UTSW	15	101712877	start gained	probably benign
R7808:Krt5	UTSW	15	101709018	missense	probably benign	0.01
R8010:Krt5	UTSW	15	101712356	missense	probably damaging	1.00
R8252:Krt5	UTSW	15	101712359	missense	probably damaging	1.00
R8696:Krt5	UTSW	15	101710307	missense	probably damaging	1.00
R8889:Krt5	UTSW	15	101710750	missense	probably benign	0.01
R8892:Krt5	UTSW	15	101710750	missense	probably benign	0.01
R9468:Krt5	UTSW	15	101707545	missense	unknown
R9578:Krt5	UTSW	15	101711718	missense	probably damaging	0.98
R9696:Krt5	UTSW	15	101707706	missense	unknown
X0019:Krt5	UTSW	15	101712368	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TTGACCTCAGCGATGATGCTGTCC -3'
(R):5'- GCTCACAGTGACTGCACAGATACC -3'

Sequencing Primer
(F):5'- ATGATGCTGTCCAGGTCCAG -3'
(R):5'- CCTTTGACCACCAGGTATGAG -3'

Posted On

2014-05-14