Incidental Mutation 'R1697:Krt5'
ID 192359
Institutional Source Beutler Lab
Gene Symbol Krt5
Ensembl Gene ENSMUSG00000061527
Gene Name keratin 5
Synonyms Tfip8, Krt2-5, 3300001P10Rik, K5
MMRRC Submission 039730-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1697 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 101615505-101621333 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 101619020 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 287 (V287A)
Ref Sequence ENSEMBL: ENSMUSP00000023709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023709]
AlphaFold Q922U2
Predicted Effect probably benign
Transcript: ENSMUST00000023709
AA Change: V287A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000023709
Gene: ENSMUSG00000061527
AA Change: V287A

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 158 3.6e-44 PFAM
Filament 161 474 1.58e-174 SMART
low complexity region 483 577 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198689
Meta Mutation Damage Score 0.2226 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the basal layer of the epidermis with family member KRT14. Mutations in these genes have been associated with a complex of diseases termed epidermolysis bullosa simplex. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within the first hour after birth. They have a loose, fragile epidermal layer and abnormal epithelium in parts of the digestive tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,992,928 (GRCm39) D250E probably damaging Het
4930571K23Rik A G 7: 124,968,201 (GRCm39) noncoding transcript Het
Acsl3 T C 1: 78,683,114 (GRCm39) probably benign Het
Acsl6 C A 11: 54,220,792 (GRCm39) T244K probably damaging Het
Adam26b T A 8: 43,974,000 (GRCm39) N334I probably damaging Het
Adgrl4 C T 3: 151,223,248 (GRCm39) T608M probably damaging Het
Aldh2 A G 5: 121,716,404 (GRCm39) probably null Het
Alms1 A G 6: 85,599,436 (GRCm39) T1890A possibly damaging Het
Capn7 C T 14: 31,082,117 (GRCm39) T441M probably damaging Het
Cd9 A T 6: 125,441,367 (GRCm39) C85S probably damaging Het
Chrm3 T C 13: 9,928,794 (GRCm39) T81A probably damaging Het
Ctif A G 18: 75,757,376 (GRCm39) probably benign Het
Dcc T A 18: 71,503,808 (GRCm39) D950V probably damaging Het
Eif4g1 T C 16: 20,498,530 (GRCm39) V422A probably damaging Het
Enthd1 A G 15: 80,337,124 (GRCm39) S437P probably damaging Het
Fads1 A G 19: 10,171,464 (GRCm39) probably benign Het
Fat3 T A 9: 15,856,176 (GRCm39) I3869L probably benign Het
Fbxw5 T A 2: 25,392,473 (GRCm39) V85E possibly damaging Het
Fcgbpl1 T A 7: 27,853,772 (GRCm39) C1579S probably damaging Het
Fem1b T C 9: 62,704,456 (GRCm39) D268G possibly damaging Het
Focad T C 4: 88,327,225 (GRCm39) L1772P probably damaging Het
Gtf3a C A 5: 146,888,723 (GRCm39) Q145K possibly damaging Het
Hacl1 T C 14: 31,342,957 (GRCm39) probably null Het
Herc2 T A 7: 55,803,653 (GRCm39) F2229L probably benign Het
Hs3st4 A T 7: 123,996,080 (GRCm39) I249L probably benign Het
Iqsec1 A T 6: 90,786,752 (GRCm39) Y7* probably null Het
Irag2 A G 6: 145,083,341 (GRCm39) probably benign Het
Klk1b1 T A 7: 43,619,750 (GRCm39) M103K probably benign Het
Lgals12 T A 19: 7,581,530 (GRCm39) Q59L possibly damaging Het
Loxl4 A G 19: 42,593,379 (GRCm39) V264A possibly damaging Het
Lrp1b T C 2: 40,712,695 (GRCm39) D3099G probably damaging Het
Mical3 G A 6: 120,984,369 (GRCm39) T169I possibly damaging Het
Muc21 A C 17: 35,931,540 (GRCm39) probably benign Het
Myef2l G A 3: 10,154,613 (GRCm39) V461I possibly damaging Het
Myh7b A C 2: 155,462,054 (GRCm39) S317R probably damaging Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Nsd1 A T 13: 55,361,872 (GRCm39) probably null Het
Nup58 A T 14: 60,482,119 (GRCm39) probably benign Het
Or1j17 C T 2: 36,578,259 (GRCm39) L82F probably damaging Het
Or2t49 A T 11: 58,392,502 (GRCm39) S293R probably damaging Het
Or5h22 A G 16: 58,895,270 (GRCm39) Y58H probably damaging Het
Or5i1 T A 2: 87,612,929 (GRCm39) I15N possibly damaging Het
Or6c2b T C 10: 128,947,737 (GRCm39) T186A probably benign Het
Pcnx2 A G 8: 126,577,087 (GRCm39) Y982H probably damaging Het
Pias3 T C 3: 96,609,541 (GRCm39) L312P probably damaging Het
Plekhm1 G A 11: 103,267,710 (GRCm39) P754S probably damaging Het
Ppp2r5c T A 12: 110,512,057 (GRCm39) L145* probably null Het
Ppp2r5c T A 12: 110,527,906 (GRCm39) probably benign Het
Pramel29 A C 4: 143,935,162 (GRCm39) I193S probably damaging Het
Proser3 T C 7: 30,239,446 (GRCm39) M553V probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Smurf2 A T 11: 106,715,514 (GRCm39) D664E possibly damaging Het
Spag9 G A 11: 93,887,391 (GRCm39) A99T probably benign Het
Stim1 T G 7: 102,003,713 (GRCm39) C49G probably damaging Het
Stk32c T C 7: 138,701,740 (GRCm39) I238V probably benign Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Tfb2m T A 1: 179,372,464 (GRCm39) E133V probably null Het
Tmem209 A T 6: 30,497,867 (GRCm39) C143S probably benign Het
Tnr T G 1: 159,679,600 (GRCm39) N191K probably benign Het
Vars1 C T 17: 35,217,198 (GRCm39) A419T probably benign Het
Vmn2r111 T C 17: 22,767,041 (GRCm39) S819G probably benign Het
Wls T C 3: 159,602,995 (GRCm39) V136A probably benign Het
Ybx2 C T 11: 69,830,887 (GRCm39) S217L probably benign Het
Zfp82 T C 7: 29,756,779 (GRCm39) D37G probably benign Het
Other mutations in Krt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Krt5 APN 15 101,621,076 (GRCm39) missense unknown
IGL01949:Krt5 APN 15 101,619,048 (GRCm39) missense probably benign 0.14
IGL03013:Krt5 APN 15 101,620,103 (GRCm39) missense probably benign 0.00
IGL03286:Krt5 APN 15 101,615,983 (GRCm39) missense unknown
R1598:Krt5 UTSW 15 101,620,876 (GRCm39) missense probably benign 0.38
R1967:Krt5 UTSW 15 101,620,094 (GRCm39) missense probably benign 0.21
R2143:Krt5 UTSW 15 101,620,794 (GRCm39) missense probably damaging 1.00
R2438:Krt5 UTSW 15 101,620,093 (GRCm39) missense probably benign 0.10
R4633:Krt5 UTSW 15 101,620,042 (GRCm39) missense probably damaging 0.98
R4771:Krt5 UTSW 15 101,617,494 (GRCm39) missense probably damaging 0.99
R4918:Krt5 UTSW 15 101,618,742 (GRCm39) missense probably damaging 1.00
R5622:Krt5 UTSW 15 101,617,470 (GRCm39) missense probably damaging 1.00
R6797:Krt5 UTSW 15 101,621,076 (GRCm39) missense unknown
R6873:Krt5 UTSW 15 101,621,312 (GRCm39) start gained probably benign
R7808:Krt5 UTSW 15 101,617,453 (GRCm39) missense probably benign 0.01
R8010:Krt5 UTSW 15 101,620,791 (GRCm39) missense probably damaging 1.00
R8252:Krt5 UTSW 15 101,620,794 (GRCm39) missense probably damaging 1.00
R8696:Krt5 UTSW 15 101,618,742 (GRCm39) missense probably damaging 1.00
R8889:Krt5 UTSW 15 101,619,185 (GRCm39) missense probably benign 0.01
R8892:Krt5 UTSW 15 101,619,185 (GRCm39) missense probably benign 0.01
R9468:Krt5 UTSW 15 101,615,980 (GRCm39) missense unknown
R9578:Krt5 UTSW 15 101,620,153 (GRCm39) missense probably damaging 0.98
R9696:Krt5 UTSW 15 101,616,141 (GRCm39) missense unknown
X0019:Krt5 UTSW 15 101,620,803 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGACCTCAGCGATGATGCTGTCC -3'
(R):5'- GCTCACAGTGACTGCACAGATACC -3'

Sequencing Primer
(F):5'- ATGATGCTGTCCAGGTCCAG -3'
(R):5'- CCTTTGACCACCAGGTATGAG -3'
Posted On 2014-05-14