Mutagenetix > Incidental Mutation

Incidental Mutation 'R1697:Vmn2r111'

192362

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

039730-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R1697 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22548060 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 819 (S819G)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

probably benign
Transcript: ENSMUST00000092491
AA Change: S819G

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: S819G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

99% (67/68)

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930486L24Rik	A	T	13: 60,845,114	D250E	probably damaging	Het
4930571K23Rik	A	G	7: 125,369,029		noncoding transcript	Het
9530053A07Rik	T	A	7: 28,154,347	C1579S	probably damaging	Het
Acsl3	T	C	1: 78,705,397		probably benign	Het
Acsl6	C	A	11: 54,329,966	T244K	probably damaging	Het
Adam26b	T	A	8: 43,520,963	N334I	probably damaging	Het
Adgrl4	C	T	3: 151,517,611	T608M	probably damaging	Het
Aldh2	A	G	5: 121,578,341		probably null	Het
Alms1	A	G	6: 85,622,454	T1890A	possibly damaging	Het
C87977	A	C	4: 144,208,592	I193S	probably damaging	Het
Capn7	C	T	14: 31,360,160	T441M	probably damaging	Het
Cd9	A	T	6: 125,464,404	C85S	probably damaging	Het
Chrm3	T	C	13: 9,878,758	T81A	probably damaging	Het
Ctif	A	G	18: 75,624,305		probably benign	Het
Dcc	T	A	18: 71,370,737	D950V	probably damaging	Het
Eif4g1	T	C	16: 20,679,780	V422A	probably damaging	Het
Enthd1	A	G	15: 80,452,923	S437P	probably damaging	Het
Fads1	A	G	19: 10,194,100		probably benign	Het
Fat3	T	A	9: 15,944,880	I3869L	probably benign	Het
Fbxw5	T	A	2: 25,502,461	V85E	possibly damaging	Het
Fem1b	T	C	9: 62,797,174	D268G	possibly damaging	Het
Focad	T	C	4: 88,408,988	L1772P	probably damaging	Het
Gm9573	A	C	17: 35,620,648		probably benign	Het
Gm9833	G	A	3: 10,089,553	V461I	possibly damaging	Het
Gtf3a	C	A	5: 146,951,913	Q145K	possibly damaging	Het
Hacl1	T	C	14: 31,621,000		probably null	Het
Herc2	T	A	7: 56,153,905	F2229L	probably benign	Het
Hs3st4	A	T	7: 124,396,857	I249L	probably benign	Het
Iqsec1	A	T	6: 90,809,770	Y7*	probably null	Het
Klk1b1	T	A	7: 43,970,326	M103K	probably benign	Het
Krt5	A	G	15: 101,710,585	V287A	probably benign	Het
Lgals12	T	A	19: 7,604,165	Q59L	possibly damaging	Het
Loxl4	A	G	19: 42,604,940	V264A	possibly damaging	Het
Lrmp	A	G	6: 145,137,615		probably benign	Het
Lrp1b	T	C	2: 40,822,683	D3099G	probably damaging	Het
Mical3	G	A	6: 121,007,408	T169I	possibly damaging	Het
Myh7b	A	C	2: 155,620,134	S317R	probably damaging	Het
Nrbp1	T	A	5: 31,245,813	I210N	probably damaging	Het
Nsd1	A	T	13: 55,214,059		probably null	Het
Nupl1	A	T	14: 60,244,670		probably benign	Het
Olfr152	T	A	2: 87,782,585	I15N	possibly damaging	Het
Olfr190	A	G	16: 59,074,907	Y58H	probably damaging	Het
Olfr331	A	T	11: 58,501,676	S293R	probably damaging	Het
Olfr346	C	T	2: 36,688,247	L82F	probably damaging	Het
Olfr769	T	C	10: 129,111,868	T186A	probably benign	Het
Pcnx2	A	G	8: 125,850,348	Y982H	probably damaging	Het
Pias3	T	C	3: 96,702,225	L312P	probably damaging	Het
Plekhm1	G	A	11: 103,376,884	P754S	probably damaging	Het
Ppp2r5c	T	A	12: 110,545,623	L145*	probably null	Het
Ppp2r5c	T	A	12: 110,561,472		probably benign	Het
Proser3	T	C	7: 30,540,021	M553V	probably benign	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Smurf2	A	T	11: 106,824,688	D664E	possibly damaging	Het
Spag9	G	A	11: 93,996,565	A99T	probably benign	Het
Stim1	T	G	7: 102,354,506	C49G	probably damaging	Het
Stk32c	T	C	7: 139,121,824	I238V	probably benign	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Tfb2m	T	A	1: 179,544,899	E133V	probably null	Het
Tmem209	A	T	6: 30,497,868	C143S	probably benign	Het
Tnr	T	G	1: 159,852,030	N191K	probably benign	Het
Vars	C	T	17: 34,998,222	A419T	probably benign	Het
Wls	T	C	3: 159,897,358	V136A	probably benign	Het
Ybx2	C	T	11: 69,940,061	S217L	probably benign	Het
Zfp82	T	C	7: 30,057,354	D37G	probably benign	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGCTTCAGGTACATATGCAGCACTAAAC -3'
(R):5'- CCAGAAACCTTCCTGGTGCCTTTAATG -3'

Sequencing Primer
(F):5'- TGCTAGGCAATATCCTTAGAGGAAAC -3'
(R):5'- CTGGTGCCTTTAATGAAGCC -3'

Posted On

2014-05-14