Incidental Mutation 'R1697:Gm9573'
ID 192364
Institutional Source Beutler Lab
Gene Symbol Gm9573
Ensembl Gene ENSMUSG00000090588
Gene Name predicted gene 9573
Synonyms Muc21, epiglycanin
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R1697 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 35617923-35626637 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to C at 35620648 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164502] [ENSMUST00000174521]
AlphaFold F7C950
Predicted Effect unknown
Transcript: ENSMUST00000164502
AA Change: L882R
SMART Domains Protein: ENSMUSP00000130987
Gene: ENSMUSG00000090588
AA Change: L882R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 39 N/A INTRINSIC
low complexity region 42 59 N/A INTRINSIC
low complexity region 76 144 N/A INTRINSIC
low complexity region 149 578 N/A INTRINSIC
low complexity region 580 653 N/A INTRINSIC
low complexity region 655 1179 N/A INTRINSIC
low complexity region 1183 1373 N/A INTRINSIC
low complexity region 1383 1436 N/A INTRINSIC
low complexity region 1438 1479 N/A INTRINSIC
Pfam:Epiglycanin_C 1518 1605 3.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173759
Predicted Effect probably benign
Transcript: ENSMUST00000174521
SMART Domains Protein: ENSMUSP00000134221
Gene: ENSMUSG00000090509

DomainStartEndE-ValueType
Pfam:SFTA2 80 117 9.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174534
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Gm9573
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB009:Gm9573 UTSW 17 35622633 intron probably benign
FR4304:Gm9573 UTSW 17 35622121 intron probably benign
R0334:Gm9573 UTSW 17 35622722 intron probably benign
R0946:Gm9573 UTSW 17 35618213 missense probably benign 0.32
R1117:Gm9573 UTSW 17 35620028 intron probably benign
R1345:Gm9573 UTSW 17 35621597 intron probably benign
R1750:Gm9573 UTSW 17 35621048 intron probably benign
R1756:Gm9573 UTSW 17 35619239 intron probably benign
R1946:Gm9573 UTSW 17 35622524 intron probably benign
R1978:Gm9573 UTSW 17 35622965 intron probably benign
R1991:Gm9573 UTSW 17 35618708 missense probably benign 0.32
R1992:Gm9573 UTSW 17 35618708 missense probably benign 0.32
R2063:Gm9573 UTSW 17 35621405 intron probably benign
R2356:Gm9573 UTSW 17 35621671 intron probably benign
R2866:Gm9573 UTSW 17 35619707 intron probably benign
R3826:Gm9573 UTSW 17 35621612 intron probably benign
R4020:Gm9573 UTSW 17 35620061 intron probably benign
R4474:Gm9573 UTSW 17 35620604 intron probably benign
R4677:Gm9573 UTSW 17 35619707 intron probably benign
R4786:Gm9573 UTSW 17 35619329 intron probably benign
R5071:Gm9573 UTSW 17 35620552 intron probably benign
R5173:Gm9573 UTSW 17 35620741 intron probably benign
R5283:Gm9573 UTSW 17 35621332 intron probably benign
R5446:Gm9573 UTSW 17 35622503 intron probably benign
R5542:Gm9573 UTSW 17 35622503 intron probably benign
R5716:Gm9573 UTSW 17 35620783 intron probably benign
R5913:Gm9573 UTSW 17 35623231 intron probably benign
R6011:Gm9573 UTSW 17 35622182 intron probably benign
R6198:Gm9573 UTSW 17 35620916 intron probably benign
R6394:Gm9573 UTSW 17 35620166 intron probably benign
R6786:Gm9573 UTSW 17 35623165 intron probably benign
R6940:Gm9573 UTSW 17 35623226 intron probably benign
R7082:Gm9573 UTSW 17 35621201 missense unknown
R7103:Gm9573 UTSW 17 35621540 missense unknown
R7110:Gm9573 UTSW 17 35622618 intron probably benign
R7139:Gm9573 UTSW 17 35622633 intron probably benign
R7165:Gm9573 UTSW 17 35621978 missense unknown
R7200:Gm9573 UTSW 17 35622633 intron probably benign
R7204:Gm9573 UTSW 17 35621213 intron probably benign
R7289:Gm9573 UTSW 17 35618869 missense unknown
R7290:Gm9573 UTSW 17 35618869 missense unknown
R7295:Gm9573 UTSW 17 35618869 missense unknown
R7319:Gm9573 UTSW 17 35622043 intron probably benign
R7462:Gm9573 UTSW 17 35620676 missense unknown
R7529:Gm9573 UTSW 17 35619231 missense unknown
R7718:Gm9573 UTSW 17 35622836 missense unknown
R7762:Gm9573 UTSW 17 35622085 missense unknown
R7788:Gm9573 UTSW 17 35618906 missense unknown
R7798:Gm9573 UTSW 17 35621254 missense unknown
R7831:Gm9573 UTSW 17 35618759 missense unknown
R7896:Gm9573 UTSW 17 35620025 missense unknown
R7899:Gm9573 UTSW 17 35620601 intron probably benign
R7932:Gm9573 UTSW 17 35622633 intron probably benign
R8025:Gm9573 UTSW 17 35620987 intron probably benign
R8077:Gm9573 UTSW 17 35619736 intron probably benign
R8090:Gm9573 UTSW 17 35621725 missense unknown
R8169:Gm9573 UTSW 17 35621180 missense unknown
R8184:Gm9573 UTSW 17 35622830 missense unknown
R8209:Gm9573 UTSW 17 35619707 intron probably benign
R8226:Gm9573 UTSW 17 35619707 intron probably benign
R8464:Gm9573 UTSW 17 35622206 intron probably benign
R8670:Gm9573 UTSW 17 35621648 missense unknown
R8783:Gm9573 UTSW 17 35619983 missense unknown
R8856:Gm9573 UTSW 17 35620973 missense unknown
R9155:Gm9573 UTSW 17 35621239 missense unknown
R9214:Gm9573 UTSW 17 35620946 missense unknown
R9353:Gm9573 UTSW 17 35619653 missense unknown
RF025:Gm9573 UTSW 17 35622879 intron probably benign
Z1176:Gm9573 UTSW 17 35621245 missense unknown
Z1177:Gm9573 UTSW 17 35620925 missense unknown
Z1177:Gm9573 UTSW 17 35621059 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGGTGGGCATAGATCCTGAGGC -3'
(R):5'- CCACTACTGCATCCAGCACTGC -3'

Sequencing Primer
(F):5'- ATAGATCCTGAGGCAGAGCT -3'
(R):5'- TAGCACTGCCTCAGGATCTAC -3'
Posted On 2014-05-14