Incidental Mutation 'R1697:Dcc'
ID192365
Institutional Source Beutler Lab
Gene Symbol Dcc
Ensembl Gene ENSMUSG00000060534
Gene Namedeleted in colorectal carcinoma
SynonymsC030036D22Rik, Igdcc1
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1697 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location71258738-72351069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71370737 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 950 (D950V)
Ref Sequence ENSEMBL: ENSMUSP00000110593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073379] [ENSMUST00000114943]
Predicted Effect probably damaging
Transcript: ENSMUST00000073379
AA Change: D930V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073094
Gene: ENSMUSG00000060534
AA Change: D930V

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
IG 46 137 9.12e-7 SMART
IGc2 152 219 1.75e-17 SMART
IGc2 252 317 4.12e-14 SMART
IGc2 343 407 8e-12 SMART
IG_like 424 520 1.06e2 SMART
FN3 429 511 6.69e-12 SMART
FN3 528 607 6.53e-15 SMART
FN3 622 705 2.09e-13 SMART
FN3 726 805 8.43e-9 SMART
FN3 824 909 2.48e-6 SMART
FN3 925 1011 1.35e-7 SMART
transmembrane domain 1079 1101 N/A INTRINSIC
Pfam:Neogenin_C 1126 1425 5.5e-129 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114943
AA Change: D950V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110593
Gene: ENSMUSG00000060534
AA Change: D950V

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
IG 46 137 9.12e-7 SMART
IGc2 152 219 1.75e-17 SMART
IGc2 252 317 4.12e-14 SMART
IGc2 343 407 8e-12 SMART
IG_like 424 520 1.06e2 SMART
FN3 429 511 6.69e-12 SMART
FN3 528 607 6.53e-15 SMART
FN3 622 705 2.09e-13 SMART
FN3 726 805 8.43e-9 SMART
FN3 844 929 2.48e-6 SMART
FN3 945 1031 1.35e-7 SMART
transmembrane domain 1099 1121 N/A INTRINSIC
Pfam:Neogenin_C 1148 1445 3.4e-113 PFAM
Meta Mutation Damage Score 0.5980 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a netrin 1 receptor. The transmembrane protein is a member of the immunoglobulin superfamily of cell adhesion molecules, and mediates axon guidance of neuronal growth cones towards sources of netrin 1 ligand. The cytoplasmic tail interacts with the tyrosine kinases Src and focal adhesion kinase (FAK, also known as PTK2) to mediate axon attraction. The protein partially localizes to lipid rafts, and induces apoptosis in the absence of ligand. The protein functions as a tumor suppressor, and is frequently mutated or downregulated in colorectal cancer and esophageal carcinoma. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous animals show defects in axonal projections and hypothalamic development affecting both visual and neruoendocrine systems. Incidence of tumors increases in mutations preventing netrin-1 binding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Dcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dcc APN 18 71384225 critical splice acceptor site probably null
IGL00781:Dcc APN 18 71809195 missense probably benign 0.25
IGL00818:Dcc APN 18 71955012 missense probably benign
IGL00895:Dcc APN 18 71810800 missense probably damaging 0.98
IGL00969:Dcc APN 18 71456883 missense probably benign 0.25
IGL01019:Dcc APN 18 71809090 missense probably benign 0.00
IGL01132:Dcc APN 18 71682174 nonsense probably null
IGL01349:Dcc APN 18 71370737 missense probably damaging 1.00
IGL01355:Dcc APN 18 71809114 missense probably benign 0.00
IGL01374:Dcc APN 18 71374553 missense probably damaging 1.00
IGL01947:Dcc APN 18 71826209 missense probably benign
IGL02470:Dcc APN 18 71955082 splice site probably benign
IGL02508:Dcc APN 18 71370702 missense probably benign 0.00
IGL02999:Dcc APN 18 71378678 missense possibly damaging 0.68
IGL03034:Dcc APN 18 71575143 nonsense probably null
IGL03118:Dcc APN 18 71420273 missense probably benign 0.00
IGL03133:Dcc APN 18 71262955 splice site probably benign
IGL03357:Dcc APN 18 71327554 missense probably damaging 1.00
Hyperrev UTSW 18 71259015 missense probably damaging 1.00
LCD18:Dcc UTSW 18 72297447 intron probably benign
P0031:Dcc UTSW 18 71384228 splice site probably benign
PIT4142001:Dcc UTSW 18 71384226 splice site probably null
R0076:Dcc UTSW 18 71321046 nonsense probably null
R0355:Dcc UTSW 18 71575208 missense possibly damaging 0.75
R0370:Dcc UTSW 18 71587985 missense possibly damaging 0.92
R0383:Dcc UTSW 18 71420263 missense probably damaging 0.99
R0541:Dcc UTSW 18 71259015 missense probably damaging 1.00
R0690:Dcc UTSW 18 71809204 splice site probably benign
R0762:Dcc UTSW 18 71342705 splice site probably benign
R0765:Dcc UTSW 18 71362990 missense probably damaging 1.00
R0846:Dcc UTSW 18 71826212 missense probably benign 0.06
R1230:Dcc UTSW 18 71682313 missense probably damaging 1.00
R1662:Dcc UTSW 18 71420338 missense probably benign 0.00
R1663:Dcc UTSW 18 71826052 missense probably damaging 1.00
R1770:Dcc UTSW 18 71446399 missense probably benign 0.01
R1781:Dcc UTSW 18 71378717 missense probably benign 0.41
R1797:Dcc UTSW 18 71367161 missense probably damaging 1.00
R2101:Dcc UTSW 18 71810870 missense possibly damaging 0.62
R2190:Dcc UTSW 18 71547420 missense possibly damaging 0.89
R2248:Dcc UTSW 18 71826168 missense probably benign 0.00
R2262:Dcc UTSW 18 71374551 missense probably damaging 1.00
R2442:Dcc UTSW 18 71456883 missense probably damaging 0.98
R3844:Dcc UTSW 18 71826186 missense probably benign 0.01
R4037:Dcc UTSW 18 72350397 missense possibly damaging 0.57
R4085:Dcc UTSW 18 71826169 missense probably benign 0.00
R4344:Dcc UTSW 18 71374490 missense probably damaging 0.99
R4499:Dcc UTSW 18 71547317 missense probably benign 0.07
R4611:Dcc UTSW 18 71548998 splice site probably null
R4811:Dcc UTSW 18 71299483 missense probably benign 0.31
R4937:Dcc UTSW 18 71542249 nonsense probably null
R5125:Dcc UTSW 18 71456877 missense probably benign 0.02
R5292:Dcc UTSW 18 71306088 missense probably damaging 1.00
R5297:Dcc UTSW 18 71378738 missense probably benign 0.00
R5317:Dcc UTSW 18 71384155 missense possibly damaging 0.78
R5691:Dcc UTSW 18 71575083 missense probably damaging 1.00
R5693:Dcc UTSW 18 71575082 missense probably damaging 1.00
R6091:Dcc UTSW 18 71809114 missense probably benign 0.00
R6291:Dcc UTSW 18 71682167 missense probably benign 0.06
R6307:Dcc UTSW 18 71810755 missense probably benign 0.15
R6343:Dcc UTSW 18 71336035 missense probably damaging 1.00
R6508:Dcc UTSW 18 71306073 missense probably damaging 1.00
R6701:Dcc UTSW 18 71809120 missense probably benign 0.02
R6810:Dcc UTSW 18 71370693 missense probably damaging 0.99
R7078:Dcc UTSW 18 71547398 missense probably benign 0.05
R7172:Dcc UTSW 18 71378684 missense probably benign 0.04
R7345:Dcc UTSW 18 71378824 missense probably benign 0.00
R7365:Dcc UTSW 18 71826123 missense probably damaging 0.98
R7395:Dcc UTSW 18 71374569 nonsense probably null
R7455:Dcc UTSW 18 71420323 missense probably benign 0.00
R7461:Dcc UTSW 18 71306034 missense probably damaging 1.00
R7485:Dcc UTSW 18 71420246 missense probably benign 0.00
R7732:Dcc UTSW 18 71446435 missense probably benign 0.24
R7886:Dcc UTSW 18 71954868 nonsense probably null
R8097:Dcc UTSW 18 71679502 missense probably damaging 1.00
R8137:Dcc UTSW 18 71378712 missense probably benign 0.00
R8188:Dcc UTSW 18 71810857 missense probably benign
R8236:Dcc UTSW 18 71955018 missense probably benign
R8802:Dcc UTSW 18 71826054 missense probably damaging 1.00
R8869:Dcc UTSW 18 71378684 missense probably benign 0.04
W0251:Dcc UTSW 18 71826083 missense probably damaging 1.00
X0020:Dcc UTSW 18 71321100 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCAAGATGCTGAGATAGACCCTCCAC -3'
(R):5'- GAAGACATCTGACTTCCACGGTAAACC -3'

Sequencing Primer
(F):5'- TGAGATAGACCCTCCACGTAGAG -3'
(R):5'- GGTAAACCATCAATTCTATACCCTG -3'
Posted On2014-05-14