Incidental Mutation 'R1697:Fads1'
ID 192368
Institutional Source Beutler Lab
Gene Symbol Fads1
Ensembl Gene ENSMUSG00000010663
Gene Name fatty acid desaturase 1
Synonyms A930006B21Rik, 0710001O03Rik
MMRRC Submission 039730-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1697 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 10160252-10174241 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 10171464 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000010807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010807]
AlphaFold Q920L1
Predicted Effect probably benign
Transcript: ENSMUST00000010807
SMART Domains Protein: ENSMUSP00000010807
Gene: ENSMUSG00000010663

DomainStartEndE-ValueType
Cyt-b5 22 97 1.32e-19 SMART
transmembrane domain 134 156 N/A INTRINSIC
Pfam:FA_desaturase 158 421 7.4e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184912
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members FADS1 and FADS2 at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit arachidonic acid deficiency with premature lethality and altered prostaglandin levels. Heterozygous mice exhibit an intermediate phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,992,928 (GRCm39) D250E probably damaging Het
4930571K23Rik A G 7: 124,968,201 (GRCm39) noncoding transcript Het
Acsl3 T C 1: 78,683,114 (GRCm39) probably benign Het
Acsl6 C A 11: 54,220,792 (GRCm39) T244K probably damaging Het
Adam26b T A 8: 43,974,000 (GRCm39) N334I probably damaging Het
Adgrl4 C T 3: 151,223,248 (GRCm39) T608M probably damaging Het
Aldh2 A G 5: 121,716,404 (GRCm39) probably null Het
Alms1 A G 6: 85,599,436 (GRCm39) T1890A possibly damaging Het
Capn7 C T 14: 31,082,117 (GRCm39) T441M probably damaging Het
Cd9 A T 6: 125,441,367 (GRCm39) C85S probably damaging Het
Chrm3 T C 13: 9,928,794 (GRCm39) T81A probably damaging Het
Ctif A G 18: 75,757,376 (GRCm39) probably benign Het
Dcc T A 18: 71,503,808 (GRCm39) D950V probably damaging Het
Eif4g1 T C 16: 20,498,530 (GRCm39) V422A probably damaging Het
Enthd1 A G 15: 80,337,124 (GRCm39) S437P probably damaging Het
Fat3 T A 9: 15,856,176 (GRCm39) I3869L probably benign Het
Fbxw5 T A 2: 25,392,473 (GRCm39) V85E possibly damaging Het
Fcgbpl1 T A 7: 27,853,772 (GRCm39) C1579S probably damaging Het
Fem1b T C 9: 62,704,456 (GRCm39) D268G possibly damaging Het
Focad T C 4: 88,327,225 (GRCm39) L1772P probably damaging Het
Gtf3a C A 5: 146,888,723 (GRCm39) Q145K possibly damaging Het
Hacl1 T C 14: 31,342,957 (GRCm39) probably null Het
Herc2 T A 7: 55,803,653 (GRCm39) F2229L probably benign Het
Hs3st4 A T 7: 123,996,080 (GRCm39) I249L probably benign Het
Iqsec1 A T 6: 90,786,752 (GRCm39) Y7* probably null Het
Irag2 A G 6: 145,083,341 (GRCm39) probably benign Het
Klk1b1 T A 7: 43,619,750 (GRCm39) M103K probably benign Het
Krt5 A G 15: 101,619,020 (GRCm39) V287A probably benign Het
Lgals12 T A 19: 7,581,530 (GRCm39) Q59L possibly damaging Het
Loxl4 A G 19: 42,593,379 (GRCm39) V264A possibly damaging Het
Lrp1b T C 2: 40,712,695 (GRCm39) D3099G probably damaging Het
Mical3 G A 6: 120,984,369 (GRCm39) T169I possibly damaging Het
Muc21 A C 17: 35,931,540 (GRCm39) probably benign Het
Myef2l G A 3: 10,154,613 (GRCm39) V461I possibly damaging Het
Myh7b A C 2: 155,462,054 (GRCm39) S317R probably damaging Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Nsd1 A T 13: 55,361,872 (GRCm39) probably null Het
Nup58 A T 14: 60,482,119 (GRCm39) probably benign Het
Or1j17 C T 2: 36,578,259 (GRCm39) L82F probably damaging Het
Or2t49 A T 11: 58,392,502 (GRCm39) S293R probably damaging Het
Or5h22 A G 16: 58,895,270 (GRCm39) Y58H probably damaging Het
Or5i1 T A 2: 87,612,929 (GRCm39) I15N possibly damaging Het
Or6c2b T C 10: 128,947,737 (GRCm39) T186A probably benign Het
Pcnx2 A G 8: 126,577,087 (GRCm39) Y982H probably damaging Het
Pias3 T C 3: 96,609,541 (GRCm39) L312P probably damaging Het
Plekhm1 G A 11: 103,267,710 (GRCm39) P754S probably damaging Het
Ppp2r5c T A 12: 110,512,057 (GRCm39) L145* probably null Het
Ppp2r5c T A 12: 110,527,906 (GRCm39) probably benign Het
Pramel29 A C 4: 143,935,162 (GRCm39) I193S probably damaging Het
Proser3 T C 7: 30,239,446 (GRCm39) M553V probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Smurf2 A T 11: 106,715,514 (GRCm39) D664E possibly damaging Het
Spag9 G A 11: 93,887,391 (GRCm39) A99T probably benign Het
Stim1 T G 7: 102,003,713 (GRCm39) C49G probably damaging Het
Stk32c T C 7: 138,701,740 (GRCm39) I238V probably benign Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Tfb2m T A 1: 179,372,464 (GRCm39) E133V probably null Het
Tmem209 A T 6: 30,497,867 (GRCm39) C143S probably benign Het
Tnr T G 1: 159,679,600 (GRCm39) N191K probably benign Het
Vars1 C T 17: 35,217,198 (GRCm39) A419T probably benign Het
Vmn2r111 T C 17: 22,767,041 (GRCm39) S819G probably benign Het
Wls T C 3: 159,602,995 (GRCm39) V136A probably benign Het
Ybx2 C T 11: 69,830,887 (GRCm39) S217L probably benign Het
Zfp82 T C 7: 29,756,779 (GRCm39) D37G probably benign Het
Other mutations in Fads1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01512:Fads1 APN 19 10,160,506 (GRCm39) missense probably benign 0.02
IGL01536:Fads1 APN 19 10,171,394 (GRCm39) missense probably benign 0.36
IGL02642:Fads1 APN 19 10,163,785 (GRCm39) missense probably damaging 1.00
big_belt UTSW 19 10,170,325 (GRCm39) nonsense probably null
teewinot UTSW 19 10,163,091 (GRCm39) nonsense probably null
R0023:Fads1 UTSW 19 10,164,261 (GRCm39) splice site probably benign
R0023:Fads1 UTSW 19 10,164,261 (GRCm39) splice site probably benign
R0367:Fads1 UTSW 19 10,160,429 (GRCm39) missense probably benign 0.12
R0464:Fads1 UTSW 19 10,160,429 (GRCm39) missense probably benign 0.12
R0465:Fads1 UTSW 19 10,160,429 (GRCm39) missense probably benign 0.12
R0534:Fads1 UTSW 19 10,160,429 (GRCm39) missense probably benign 0.12
R0848:Fads1 UTSW 19 10,160,429 (GRCm39) missense probably benign 0.12
R1456:Fads1 UTSW 19 10,163,116 (GRCm39) missense probably benign 0.06
R5576:Fads1 UTSW 19 10,163,238 (GRCm39) missense probably benign 0.00
R5640:Fads1 UTSW 19 10,163,767 (GRCm39) missense probably damaging 1.00
R6243:Fads1 UTSW 19 10,163,091 (GRCm39) nonsense probably null
R6379:Fads1 UTSW 19 10,160,551 (GRCm39) missense probably damaging 1.00
R7593:Fads1 UTSW 19 10,162,361 (GRCm39) missense probably damaging 1.00
R7845:Fads1 UTSW 19 10,171,405 (GRCm39) missense probably damaging 1.00
R8787:Fads1 UTSW 19 10,170,325 (GRCm39) nonsense probably null
R8856:Fads1 UTSW 19 10,170,276 (GRCm39) missense probably benign 0.05
R9090:Fads1 UTSW 19 10,163,162 (GRCm39) missense probably damaging 1.00
R9271:Fads1 UTSW 19 10,163,162 (GRCm39) missense probably damaging 1.00
Z1176:Fads1 UTSW 19 10,171,068 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACAGGTGACAGATGGGTCTGC -3'
(R):5'- GGCCACTGAACCAGTTGTTGAAGG -3'

Sequencing Primer
(F):5'- CATTGGCTTGGGAAAGTCAC -3'
(R):5'- CAGGTCTCCATGTCAGAGTG -3'
Posted On 2014-05-14