Incidental Mutation 'R1697:Fads1'
ID192368
Institutional Source Beutler Lab
Gene Symbol Fads1
Ensembl Gene ENSMUSG00000010663
Gene Namefatty acid desaturase 1
SynonymsA930006B21Rik, 0710001O03Rik
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1697 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10182888-10196870 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 10194100 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000010807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010807]
Predicted Effect probably benign
Transcript: ENSMUST00000010807
SMART Domains Protein: ENSMUSP00000010807
Gene: ENSMUSG00000010663

DomainStartEndE-ValueType
Cyt-b5 22 97 1.32e-19 SMART
transmembrane domain 134 156 N/A INTRINSIC
Pfam:FA_desaturase 158 421 7.4e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184912
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members FADS1 and FADS2 at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit arachidonic acid deficiency with premature lethality and altered prostaglandin levels. Heterozygous mice exhibit an intermediate phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Fads1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01512:Fads1 APN 19 10183142 missense probably benign 0.02
IGL01536:Fads1 APN 19 10194030 missense probably benign 0.36
IGL02642:Fads1 APN 19 10186421 missense probably damaging 1.00
teewinot UTSW 19 10185727 nonsense probably null
R0023:Fads1 UTSW 19 10186897 splice site probably benign
R0023:Fads1 UTSW 19 10186897 splice site probably benign
R0367:Fads1 UTSW 19 10183065 missense probably benign 0.12
R0464:Fads1 UTSW 19 10183065 missense probably benign 0.12
R0465:Fads1 UTSW 19 10183065 missense probably benign 0.12
R0534:Fads1 UTSW 19 10183065 missense probably benign 0.12
R0848:Fads1 UTSW 19 10183065 missense probably benign 0.12
R1456:Fads1 UTSW 19 10185752 missense probably benign 0.06
R5576:Fads1 UTSW 19 10185874 missense probably benign 0.00
R5640:Fads1 UTSW 19 10186403 missense probably damaging 1.00
R6243:Fads1 UTSW 19 10185727 nonsense probably null
R6379:Fads1 UTSW 19 10183187 missense probably damaging 1.00
R7593:Fads1 UTSW 19 10184997 missense probably damaging 1.00
R7845:Fads1 UTSW 19 10194041 missense probably damaging 1.00
R8787:Fads1 UTSW 19 10192961 nonsense probably null
R8856:Fads1 UTSW 19 10192912 missense probably benign 0.05
Z1176:Fads1 UTSW 19 10193704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACAGGTGACAGATGGGTCTGC -3'
(R):5'- GGCCACTGAACCAGTTGTTGAAGG -3'

Sequencing Primer
(F):5'- CATTGGCTTGGGAAAGTCAC -3'
(R):5'- CAGGTCTCCATGTCAGAGTG -3'
Posted On2014-05-14