Incidental Mutation 'R1697:Loxl4'
ID192369
Institutional Source Beutler Lab
Gene Symbol Loxl4
Ensembl Gene ENSMUSG00000025185
Gene Namelysyl oxidase-like 4
Synonyms
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1697 (G1)
Quality Score121
Status Validated
Chromosome19
Chromosomal Location42593982-42612813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42604940 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 264 (V264A)
Ref Sequence ENSEMBL: ENSMUSP00000125803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026190] [ENSMUST00000164786] [ENSMUST00000166128] [ENSMUST00000171432]
Predicted Effect probably benign
Transcript: ENSMUST00000026190
AA Change: V264A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000026190
Gene: ENSMUSG00000025185
AA Change: V264A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 33 134 1.57e-49 SMART
SR 160 288 3.96e-14 SMART
SR 312 412 2.6e-41 SMART
SR 422 530 5.41e-30 SMART
Pfam:Lysyl_oxidase 534 737 1.3e-113 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164014
Predicted Effect possibly damaging
Transcript: ENSMUST00000164786
AA Change: V264A

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125803
Gene: ENSMUSG00000025185
AA Change: V264A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 33 134 1.57e-49 SMART
SR 160 288 3.96e-14 SMART
SR 313 413 2.6e-41 SMART
SR 423 531 5.41e-30 SMART
Pfam:Lysyl_oxidase 535 735 1.8e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166128
SMART Domains Protein: ENSMUSP00000126552
Gene: ENSMUSG00000025185

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
SR 46 147 1.57e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171432
AA Change: V264A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000126686
Gene: ENSMUSG00000025185
AA Change: V264A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 33 134 1.57e-49 SMART
SR 160 288 3.96e-14 SMART
SR 312 412 2.6e-41 SMART
SR 422 530 5.41e-30 SMART
Pfam:Lysyl_oxidase 534 737 1.3e-113 PFAM
Meta Mutation Damage Score 0.0911 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lysyl oxidase gene family. The prototypic member of the family is essential to the biogenesis of connective tissue, encoding an extracellular copper-dependent amine oxidase that catalyses the first step in the formation of crosslinks in collagens and elastin. A highly conserved amino acid sequence at the C-terminus end appears to be sufficient for amine oxidase activity, suggesting that each family member may retain this function. The N-terminus is poorly conserved and may impart additional roles in developmental regulation, senescence, tumor suppression, cell growth control, and chemotaxis to each member of the family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Loxl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Loxl4 APN 19 42597549 missense probably damaging 1.00
IGL02063:Loxl4 APN 19 42608339 missense probably benign 0.03
IGL02490:Loxl4 APN 19 42604830 missense probably benign
IGL02498:Loxl4 APN 19 42604973 missense probably benign 0.27
IGL03107:Loxl4 APN 19 42605279 missense probably benign 0.12
IGL03296:Loxl4 APN 19 42598823 splice site probably benign
R1145:Loxl4 UTSW 19 42608555 unclassified probably benign
R2126:Loxl4 UTSW 19 42603963 missense probably damaging 1.00
R2128:Loxl4 UTSW 19 42603963 missense probably damaging 1.00
R2148:Loxl4 UTSW 19 42604192 splice site probably null
R2159:Loxl4 UTSW 19 42600007 missense probably damaging 1.00
R3624:Loxl4 UTSW 19 42607576 missense probably benign 0.28
R4030:Loxl4 UTSW 19 42608359 missense probably damaging 1.00
R4181:Loxl4 UTSW 19 42607591 missense probably benign 0.00
R4302:Loxl4 UTSW 19 42607591 missense probably benign 0.00
R4700:Loxl4 UTSW 19 42607613 missense probably benign 0.07
R4701:Loxl4 UTSW 19 42607613 missense probably benign 0.07
R4719:Loxl4 UTSW 19 42607591 missense probably benign 0.00
R4724:Loxl4 UTSW 19 42608346 missense probably benign 0.23
R4750:Loxl4 UTSW 19 42605004 missense probably damaging 1.00
R4953:Loxl4 UTSW 19 42610694 unclassified probably benign
R5579:Loxl4 UTSW 19 42604290 missense probably damaging 1.00
R5840:Loxl4 UTSW 19 42598715 missense probably damaging 1.00
R5856:Loxl4 UTSW 19 42595366 missense possibly damaging 0.89
R5879:Loxl4 UTSW 19 42607627 missense probably benign 0.09
R6137:Loxl4 UTSW 19 42598793 missense probably damaging 1.00
R6180:Loxl4 UTSW 19 42608352 missense probably damaging 1.00
R6324:Loxl4 UTSW 19 42595378 missense probably benign 0.00
R6347:Loxl4 UTSW 19 42608270 missense probably damaging 1.00
R6646:Loxl4 UTSW 19 42598781 missense probably damaging 1.00
R6788:Loxl4 UTSW 19 42608353 missense probably damaging 1.00
R7045:Loxl4 UTSW 19 42606635 missense probably damaging 1.00
R8013:Loxl4 UTSW 19 42607676 missense probably damaging 1.00
R8072:Loxl4 UTSW 19 42607582 missense probably damaging 1.00
R8546:Loxl4 UTSW 19 42607588 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCCCAAGGAGTCCAGCTCCTC -3'
(R):5'- GGAAGAGCAGCCATCCCTATCTGTG -3'

Sequencing Primer
(F):5'- TCTACCCCACTGAGCAGG -3'
(R):5'- ctcccccctcctcttatcc -3'
Posted On2014-05-14