Incidental Mutation 'R1698:Cep350'
ID192371
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Namecentrosomal protein 350
Synonyms6430546F08Rik, 4933409L06Rik
MMRRC Submission 039731-MU
Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R1698 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location155844964-155973255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155953358 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 267 (I267V)
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124495] [ENSMUST00000138762]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104231
Predicted Effect possibly damaging
Transcript: ENSMUST00000124495
AA Change: I207V

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000138762
AA Change: I267V

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: I267V

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,645,158 E340A possibly damaging Het
Abca13 A G 11: 9,314,507 D2963G probably benign Het
Actn3 T C 19: 4,862,207 D783G possibly damaging Het
Adamtsl2 A G 2: 27,103,127 E723G possibly damaging Het
Agrn G T 4: 156,166,558 Q1931K probably benign Het
Ankrd27 G A 7: 35,614,521 A426T probably benign Het
Atg9b C A 5: 24,388,188 G406C probably damaging Het
BC005561 C T 5: 104,520,510 A966V probably benign Het
C1ra A T 6: 124,522,766 Q637L probably benign Het
Cdhr2 A T 13: 54,719,581 M438L probably benign Het
Chrna5 A G 9: 55,004,642 Y138C probably damaging Het
Chst3 T A 10: 60,185,703 M441L probably benign Het
Cmya5 G A 13: 93,063,519 P3434S probably benign Het
Cog2 T A 8: 124,525,683 L42Q probably damaging Het
Cpq A T 15: 33,250,126 I210F probably benign Het
Crnn C A 3: 93,148,458 Q184K probably damaging Het
Csnka2ip A T 16: 64,478,059 Y647* probably null Het
D5Ertd579e C T 5: 36,604,530 R1331H probably benign Het
Dennd5a C T 7: 109,917,380 probably null Het
Dync1h1 A G 12: 110,626,992 Q1231R possibly damaging Het
Erbin T A 13: 103,833,731 I1126F possibly damaging Het
Fastkd1 T C 2: 69,702,469 D518G probably benign Het
Gcc1 A G 6: 28,421,111 L69P possibly damaging Het
Gkn1 T C 6: 87,347,169 Y119C probably damaging Het
Gmpr T G 13: 45,517,044 W81G probably benign Het
Gyg T A 3: 20,138,051 I236F probably benign Het
Hcrtr2 T C 9: 76,246,453 Y219C probably damaging Het
Hmcn1 G A 1: 150,565,369 Q5379* probably null Het
Kank1 T C 19: 25,411,317 C785R probably benign Het
Lrp1b A T 2: 40,851,806 C3036* probably null Het
Mdga2 T C 12: 66,689,335 D373G probably damaging Het
Mgat2 A T 12: 69,185,719 I356F probably benign Het
Miga2 A G 2: 30,377,997 D346G probably damaging Het
Mprip T A 11: 59,760,258 L1596Q possibly damaging Het
Mroh2b G A 15: 4,914,140 R386Q probably benign Het
Mst1r T A 9: 107,919,980 S1349R probably benign Het
Mtmr3 C T 11: 4,492,825 R403H possibly damaging Het
Mycbpap G A 11: 94,508,143 Q460* probably null Het
Myo9a T C 9: 59,868,181 V1025A probably benign Het
Ncapd2 C T 6: 125,168,590 E1365K probably null Het
Nkiras2 C A 11: 100,625,163 D105E probably damaging Het
Nolc1 T G 19: 46,081,431 probably null Het
Nos1 T C 5: 117,867,232 F6L probably benign Het
Olfr1112 G T 2: 87,191,737 V17L probably benign Het
Olfr1278 T A 2: 111,292,560 C97* probably null Het
Olfr1369-ps1 C T 13: 21,116,565 T291I probably benign Het
Olfr218 A T 1: 173,203,371 N5I probably damaging Het
Olfr325 T C 11: 58,581,251 Y136H probably damaging Het
Olfr910 T A 9: 38,539,256 Y120* probably null Het
Pfkm A G 15: 98,128,318 E598G possibly damaging Het
Phf2 A T 13: 48,807,630 D861E unknown Het
Polr2a A G 11: 69,739,877 probably null Het
Popdc2 G A 16: 38,369,491 V167M probably damaging Het
Ptpn22 T C 3: 103,885,798 S422P probably benign Het
Rasa2 T C 9: 96,568,375 K490R possibly damaging Het
Rbfox3 T A 11: 118,495,221 D286V probably damaging Het
Rdh13 A G 7: 4,427,791 W223R probably damaging Het
Riok3 T C 18: 12,128,929 S7P probably benign Het
Rnaseh2b A G 14: 62,353,632 E144G probably benign Het
Rnf20 C T 4: 49,651,498 Q655* probably null Het
Rpap2 T C 5: 107,603,550 Y8H probably damaging Het
Slc5a10 T C 11: 61,709,602 Y181C probably benign Het
Snd1 G T 6: 28,888,253 G896* probably null Het
Spast C T 17: 74,356,160 Q158* probably null Het
Tas2r104 G A 6: 131,685,584 S54F probably damaging Het
Tcaf2 C T 6: 42,628,017 W611* probably null Het
Timp4 G A 6: 115,250,403 probably null Het
Tmem45a G A 16: 56,823,570 S72L probably benign Het
Tnrc18 T C 5: 142,788,703 T124A possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttn T C 2: 76,942,915 D2381G probably damaging Het
Uevld T C 7: 46,955,624 T41A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc5d T C 8: 28,696,478 E527G probably damaging Het
Vmn2r125 C T 4: 156,351,038 T237I probably benign Het
Vmn2r63 A C 7: 42,933,614 I59S probably benign Het
Vps72 G A 3: 95,118,695 S106N probably benign Het
Zan A C 5: 137,409,669 probably benign Het
Zbtb38 T C 9: 96,685,462 K1190E probably benign Het
Zc3h6 T C 2: 129,017,358 V1103A probably benign Het
Zfp407 G A 18: 84,562,157 T277I probably damaging Het
Zfp804b A G 5: 6,769,509 S1149P probably damaging Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155940746 missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155862204 missense probably benign
IGL00837:Cep350 APN 1 155953391 missense probably damaging 1.00
IGL00977:Cep350 APN 1 155932865 missense probably null 0.99
IGL01544:Cep350 APN 1 155953187 missense probably damaging 1.00
IGL01616:Cep350 APN 1 155953247 missense probably benign 0.00
IGL01695:Cep350 APN 1 155944158 missense probably damaging 1.00
IGL01902:Cep350 APN 1 155861985 missense probably damaging 1.00
IGL01977:Cep350 APN 1 155911968 missense probably benign 0.01
IGL02388:Cep350 APN 1 155953753 missense probably benign 0.28
IGL02475:Cep350 APN 1 155862595 missense probably damaging 1.00
IGL02528:Cep350 APN 1 155894615 missense probably damaging 1.00
IGL02598:Cep350 APN 1 155862967 missense probably benign 0.00
IGL02676:Cep350 APN 1 155862231 missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155953222 missense probably benign 0.02
IGL02744:Cep350 APN 1 155931533 missense probably damaging 0.98
IGL02817:Cep350 APN 1 155928842 missense probably damaging 1.00
IGL02892:Cep350 APN 1 155868806 missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155858042 missense probably damaging 1.00
IGL03166:Cep350 APN 1 155863600 missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155860627 missense probably benign 0.06
IGL03268:Cep350 APN 1 155953549 missense probably benign 0.16
IGL03358:Cep350 APN 1 155928539 missense probably benign
NA:Cep350 UTSW 1 155958648 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0172:Cep350 UTSW 1 155953447 missense probably benign 0.00
R0365:Cep350 UTSW 1 155906571 missense probably benign 0.00
R0472:Cep350 UTSW 1 155914723 missense probably damaging 0.99
R0502:Cep350 UTSW 1 155900883 splice site probably null
R0538:Cep350 UTSW 1 155848620 missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155901435 splice site probably null
R0565:Cep350 UTSW 1 155961195 splice site probably benign
R0607:Cep350 UTSW 1 155872048 missense probably damaging 1.00
R0645:Cep350 UTSW 1 155940712 splice site probably null
R0675:Cep350 UTSW 1 155959753 missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155953246 missense probably benign 0.00
R0863:Cep350 UTSW 1 155862235 missense probably benign 0.00
R0969:Cep350 UTSW 1 155940826 missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155931518 missense probably damaging 1.00
R1186:Cep350 UTSW 1 155875376 missense probably damaging 1.00
R1552:Cep350 UTSW 1 155910738 missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155929079 missense possibly damaging 0.48
R1729:Cep350 UTSW 1 155911981 missense probably benign 0.17
R1735:Cep350 UTSW 1 155953214 missense probably damaging 0.99
R1740:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R1783:Cep350 UTSW 1 155928865 missense probably damaging 1.00
R1844:Cep350 UTSW 1 155848628 missense probably damaging 0.99
R1848:Cep350 UTSW 1 155953651 missense probably benign 0.28
R1988:Cep350 UTSW 1 155933104 missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155914721 missense probably benign 0.16
R2241:Cep350 UTSW 1 155958556 splice site probably null
R2245:Cep350 UTSW 1 155879020 missense probably benign 0.10
R2402:Cep350 UTSW 1 155863136 missense probably benign
R2566:Cep350 UTSW 1 155959718 critical splice donor site probably null
R3160:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3162:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3769:Cep350 UTSW 1 155953204 missense probably damaging 1.00
R4035:Cep350 UTSW 1 155959795 missense probably benign 0.06
R4158:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4160:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4213:Cep350 UTSW 1 155935961 missense probably damaging 1.00
R4483:Cep350 UTSW 1 155926468 missense probably benign 0.01
R4648:Cep350 UTSW 1 155902598 missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155928586 missense probably damaging 1.00
R4836:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R4839:Cep350 UTSW 1 155928494 missense probably benign 0.00
R4969:Cep350 UTSW 1 155860279 missense probably damaging 0.99
R5014:Cep350 UTSW 1 155928206 missense probably benign 0.00
R5027:Cep350 UTSW 1 155933354 missense probably benign 0.01
R5144:Cep350 UTSW 1 155911150 missense probably damaging 0.99
R5153:Cep350 UTSW 1 155935946 missense probably damaging 1.00
R5165:Cep350 UTSW 1 155928368 missense probably damaging 1.00
R5182:Cep350 UTSW 1 155858108 missense probably damaging 1.00
R5445:Cep350 UTSW 1 155894723 missense probably benign 0.01
R5738:Cep350 UTSW 1 155866078 missense probably damaging 1.00
R5809:Cep350 UTSW 1 155933341 missense probably damaging 0.98
R5855:Cep350 UTSW 1 155953762 missense probably benign 0.00
R6103:Cep350 UTSW 1 155924576 missense probably benign 0.05
R6139:Cep350 UTSW 1 155953279 missense probably benign 0.03
R6285:Cep350 UTSW 1 155953374 missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155894673 missense probably damaging 1.00
R6446:Cep350 UTSW 1 155862154 missense probably benign
R6520:Cep350 UTSW 1 155933336 missense probably benign 0.02
R6712:Cep350 UTSW 1 155858106 missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155928551 missense probably benign 0.01
R7020:Cep350 UTSW 1 155928331 missense probably damaging 1.00
R7056:Cep350 UTSW 1 155848627 missense probably damaging 1.00
R7141:Cep350 UTSW 1 155914748 missense probably damaging 1.00
R7215:Cep350 UTSW 1 155894707 missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155910753 missense probably damaging 1.00
R7272:Cep350 UTSW 1 155953588 missense probably damaging 0.98
R7336:Cep350 UTSW 1 155862276 missense probably benign 0.17
R7361:Cep350 UTSW 1 155901491 missense probably damaging 1.00
R7390:Cep350 UTSW 1 155866087 missense possibly damaging 0.94
R7402:Cep350 UTSW 1 155928215 missense probably benign 0.00
R7428:Cep350 UTSW 1 155894619 missense probably benign 0.00
R7440:Cep350 UTSW 1 155940772 missense probably damaging 0.98
R7520:Cep350 UTSW 1 155915629 missense probably benign 0.05
R7529:Cep350 UTSW 1 155861923 missense probably benign 0.08
R7635:Cep350 UTSW 1 155879021 nonsense probably null
R7806:Cep350 UTSW 1 155862063 missense probably benign 0.00
RF020:Cep350 UTSW 1 155915478 missense probably benign 0.34
X0018:Cep350 UTSW 1 155953286 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CCAACCTTTGTATGCTGGAGCAGG -3'
(R):5'- TGTATTCACGAGGAGAAGCCCGAG -3'

Sequencing Primer
(F):5'- GGTGCTGTTGCCACTTTC -3'
(R):5'- CCTCGGTCATCAGTGATACAG -3'
Posted On2014-05-14