Mutagenetix > Incidental Mutations

Incidental Mutation 'R1698:Adamtsl2'

192373

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl2

Ensembl Gene

ENSMUSG00000036040

Gene Name

ADAMTS-like 2

Synonyms

A930008K15Rik

MMRRC Submission

039731-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1698 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27079379-27108981 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27103127 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 723 (E723G)

Ref Sequence

ENSEMBL: ENSMUSP00000088774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091233]

AlphaFold

Q7TSK7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000091233
AA Change: E723G

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000088774
Gene: ENSMUSG00000036040
AA Change: E723G

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSP1	50	106	5.14e-7	SMART
Pfam:ADAM_spacer1	214	331	5.4e-28	PFAM
low complexity region	345	358	N/A	INTRINSIC
TSP1	573	629	8.15e-1	SMART
TSP1	631	692	1.85e-2	SMART
TSP1	694	744	4.15e-1	SMART
TSP1	747	796	9.98e-5	SMART
TSP1	803	861	4.95e-2	SMART
TSP1	863	914	2.53e-6	SMART
Pfam:PLAC	922	953	1.4e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130600

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139633

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143246

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169787

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice die shortly after birth, are cyanotic and exhibit respiratory distress. Severe bronchial epithelial dysplasia with abnormal glycogen-rich inclusions in the bronchial epithelium is observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	C	6: 121,645,158	E340A	possibly damaging	Het
Abca13	A	G	11: 9,314,507	D2963G	probably benign	Het
Actn3	T	C	19: 4,862,207	D783G	possibly damaging	Het
Agrn	G	T	4: 156,166,558	Q1931K	probably benign	Het
Ankrd27	G	A	7: 35,614,521	A426T	probably benign	Het
Atg9b	C	A	5: 24,388,188	G406C	probably damaging	Het
BC005561	C	T	5: 104,520,510	A966V	probably benign	Het
C1ra	A	T	6: 124,522,766	Q637L	probably benign	Het
Cdhr2	A	T	13: 54,719,581	M438L	probably benign	Het
Cep350	T	C	1: 155,953,358	I267V	possibly damaging	Het
Chrna5	A	G	9: 55,004,642	Y138C	probably damaging	Het
Chst3	T	A	10: 60,185,703	M441L	probably benign	Het
Cmya5	G	A	13: 93,063,519	P3434S	probably benign	Het
Cog2	T	A	8: 124,525,683	L42Q	probably damaging	Het
Cpq	A	T	15: 33,250,126	I210F	probably benign	Het
Crnn	C	A	3: 93,148,458	Q184K	probably damaging	Het
Csnka2ip	A	T	16: 64,478,059	Y647*	probably null	Het
D5Ertd579e	C	T	5: 36,604,530	R1331H	probably benign	Het
Dennd5a	C	T	7: 109,917,380		probably null	Het
Dync1h1	A	G	12: 110,626,992	Q1231R	possibly damaging	Het
Erbin	T	A	13: 103,833,731	I1126F	possibly damaging	Het
Fastkd1	T	C	2: 69,702,469	D518G	probably benign	Het
Gcc1	A	G	6: 28,421,111	L69P	possibly damaging	Het
Gkn1	T	C	6: 87,347,169	Y119C	probably damaging	Het
Gmpr	T	G	13: 45,517,044	W81G	probably benign	Het
Gyg	T	A	3: 20,138,051	I236F	probably benign	Het
Hcrtr2	T	C	9: 76,246,453	Y219C	probably damaging	Het
Hmcn1	G	A	1: 150,565,369	Q5379*	probably null	Het
Kank1	T	C	19: 25,411,317	C785R	probably benign	Het
Lrp1b	A	T	2: 40,851,806	C3036*	probably null	Het
Mdga2	T	C	12: 66,689,335	D373G	probably damaging	Het
Mgat2	A	T	12: 69,185,719	I356F	probably benign	Het
Miga2	A	G	2: 30,377,997	D346G	probably damaging	Het
Mprip	T	A	11: 59,760,258	L1596Q	possibly damaging	Het
Mroh2b	G	A	15: 4,914,140	R386Q	probably benign	Het
Mst1r	T	A	9: 107,919,980	S1349R	probably benign	Het
Mtmr3	C	T	11: 4,492,825	R403H	possibly damaging	Het
Mycbpap	G	A	11: 94,508,143	Q460*	probably null	Het
Myo9a	T	C	9: 59,868,181	V1025A	probably benign	Het
Ncapd2	C	T	6: 125,168,590	E1365K	probably null	Het
Nkiras2	C	A	11: 100,625,163	D105E	probably damaging	Het
Nolc1	T	G	19: 46,081,431		probably null	Het
Nos1	T	C	5: 117,867,232	F6L	probably benign	Het
Olfr1112	G	T	2: 87,191,737	V17L	probably benign	Het
Olfr1278	T	A	2: 111,292,560	C97*	probably null	Het
Olfr1369-ps1	C	T	13: 21,116,565	T291I	probably benign	Het
Olfr218	A	T	1: 173,203,371	N5I	probably damaging	Het
Olfr325	T	C	11: 58,581,251	Y136H	probably damaging	Het
Olfr910	T	A	9: 38,539,256	Y120*	probably null	Het
Pfkm	A	G	15: 98,128,318	E598G	possibly damaging	Het
Phf2	A	T	13: 48,807,630	D861E	unknown	Het
Polr2a	A	G	11: 69,739,877		probably null	Het
Popdc2	G	A	16: 38,369,491	V167M	probably damaging	Het
Ptpn22	T	C	3: 103,885,798	S422P	probably benign	Het
Rasa2	T	C	9: 96,568,375	K490R	possibly damaging	Het
Rbfox3	T	A	11: 118,495,221	D286V	probably damaging	Het
Rdh13	A	G	7: 4,427,791	W223R	probably damaging	Het
Riok3	T	C	18: 12,128,929	S7P	probably benign	Het
Rnaseh2b	A	G	14: 62,353,632	E144G	probably benign	Het
Rnf20	C	T	4: 49,651,498	Q655*	probably null	Het
Rpap2	T	C	5: 107,603,550	Y8H	probably damaging	Het
Slc5a10	T	C	11: 61,709,602	Y181C	probably benign	Het
Snd1	G	T	6: 28,888,253	G896*	probably null	Het
Spast	C	T	17: 74,356,160	Q158*	probably null	Het
Tas2r104	G	A	6: 131,685,584	S54F	probably damaging	Het
Tcaf2	C	T	6: 42,628,017	W611*	probably null	Het
Timp4	G	A	6: 115,250,403		probably null	Het
Tmem45a	G	A	16: 56,823,570	S72L	probably benign	Het
Tnrc18	T	C	5: 142,788,703	T124A	possibly damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Ttn	T	C	2: 76,942,915	D2381G	probably damaging	Het
Uevld	T	C	7: 46,955,624	T41A	possibly damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Unc5d	T	C	8: 28,696,478	E527G	probably damaging	Het
Vmn2r125	C	T	4: 156,351,038	T237I	probably benign	Het
Vmn2r63	A	C	7: 42,933,614	I59S	probably benign	Het
Vps72	G	A	3: 95,118,695	S106N	probably benign	Het
Zan	A	C	5: 137,409,669		probably benign	Het
Zbtb38	T	C	9: 96,685,462	K1190E	probably benign	Het
Zc3h6	T	C	2: 129,017,358	V1103A	probably benign	Het
Zfp407	G	A	18: 84,562,157	T277I	probably damaging	Het
Zfp804b	A	G	5: 6,769,509	S1149P	probably damaging	Het

Other mutations in Adamtsl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Adamtsl2	APN	2	27085088	missense	probably damaging	1.00
IGL01902:Adamtsl2	APN	2	27087252	missense	probably damaging	1.00
IGL02207:Adamtsl2	APN	2	27102981	missense	probably damaging	0.99
IGL02247:Adamtsl2	APN	2	27084893	missense	probably damaging	1.00
IGL02253:Adamtsl2	APN	2	27098697	missense	possibly damaging	0.48
IGL02655:Adamtsl2	APN	2	27082530	splice site	probably benign
IGL03148:Adamtsl2	APN	2	27084059	missense	probably damaging	0.99
IGL03269:Adamtsl2	APN	2	27108355	nonsense	probably null
R0609:Adamtsl2	UTSW	2	27089635	missense	probably benign	0.25
R1183:Adamtsl2	UTSW	2	27084080	missense	probably damaging	1.00
R1443:Adamtsl2	UTSW	2	27103066	missense	possibly damaging	0.89
R1675:Adamtsl2	UTSW	2	27082485	frame shift	probably null
R1765:Adamtsl2	UTSW	2	27102830	missense	probably benign	0.01
R1934:Adamtsl2	UTSW	2	27089593	missense	probably damaging	0.99
R2106:Adamtsl2	UTSW	2	27102825	missense	probably benign	0.02
R2108:Adamtsl2	UTSW	2	27095558	missense	probably benign
R2189:Adamtsl2	UTSW	2	27081738	missense	probably benign	0.00
R2232:Adamtsl2	UTSW	2	27103178	missense	probably damaging	1.00
R4301:Adamtsl2	UTSW	2	27087283	missense	probably null	1.00
R4518:Adamtsl2	UTSW	2	27095547	missense	probably benign	0.00
R4572:Adamtsl2	UTSW	2	27083256	missense	probably damaging	0.99
R4627:Adamtsl2	UTSW	2	27093585	missense	probably damaging	0.99
R4668:Adamtsl2	UTSW	2	27095475	missense	probably benign	0.00
R4686:Adamtsl2	UTSW	2	27093825	missense	probably damaging	0.99
R4821:Adamtsl2	UTSW	2	27098592	splice site	probably null
R5054:Adamtsl2	UTSW	2	27101720	missense	probably damaging	1.00
R5460:Adamtsl2	UTSW	2	27095398	splice site	probably null
R5569:Adamtsl2	UTSW	2	27102833	missense	probably damaging	1.00
R5694:Adamtsl2	UTSW	2	27081724	missense	probably benign	0.03
R6836:Adamtsl2	UTSW	2	27081706	start codon destroyed	probably null	0.90
R7103:Adamtsl2	UTSW	2	27107461	missense	probably damaging	1.00
R7437:Adamtsl2	UTSW	2	27089709	missense	probably damaging	0.99
R8089:Adamtsl2	UTSW	2	27104797	missense	probably benign	0.00
R8389:Adamtsl2	UTSW	2	27103124	missense	possibly damaging	0.71
X0003:Adamtsl2	UTSW	2	27081772	small deletion	probably benign
X0003:Adamtsl2	UTSW	2	27081773	small deletion	probably benign
Z1176:Adamtsl2	UTSW	2	27081720	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GTGTACAGTGACCTCTGTGAAGCC -3'
(R):5'- GTTTGAGTCCCTACACGAGTGGAAG -3'

Sequencing Primer
(F):5'- TCTGTGAAGCCACGGAGG -3'
(R):5'- TGTCTCTTTACTCCACATAGATGAG -3'

Posted On

2014-05-14