Incidental Mutation 'R1698:Fastkd1'
ID 192376
Institutional Source Beutler Lab
Gene Symbol Fastkd1
Ensembl Gene ENSMUSG00000027086
Gene Name FAST kinase domains 1
Synonyms 5330408N05Rik
MMRRC Submission 039731-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R1698 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 69517159-69543860 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 69532813 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 518 (D518G)
Ref Sequence ENSEMBL: ENSMUSP00000099767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073152] [ENSMUST00000102706]
AlphaFold Q6DI86
Predicted Effect probably benign
Transcript: ENSMUST00000073152
AA Change: D518G

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072896
Gene: ENSMUSG00000027086
AA Change: D518G

DomainStartEndE-ValueType
low complexity region 179 191 N/A INTRINSIC
low complexity region 316 324 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
Pfam:FAST_1 560 628 6.6e-25 PFAM
Pfam:FAST_2 645 730 6.4e-26 PFAM
RAP 763 822 4.38e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102706
AA Change: D518G

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099767
Gene: ENSMUSG00000027086
AA Change: D518G

DomainStartEndE-ValueType
low complexity region 179 191 N/A INTRINSIC
low complexity region 316 324 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
Pfam:FAST_1 530 600 2.2e-26 PFAM
Pfam:FAST_2 614 701 4.4e-31 PFAM
RAP 734 793 4.38e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140776
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,622,117 (GRCm39) E340A possibly damaging Het
Abca13 A G 11: 9,264,507 (GRCm39) D2963G probably benign Het
Actn3 T C 19: 4,912,235 (GRCm39) D783G possibly damaging Het
Adamtsl2 A G 2: 26,993,139 (GRCm39) E723G possibly damaging Het
Agrn G T 4: 156,251,015 (GRCm39) Q1931K probably benign Het
Ankrd27 G A 7: 35,313,946 (GRCm39) A426T probably benign Het
Atg9b C A 5: 24,593,186 (GRCm39) G406C probably damaging Het
C1ra A T 6: 124,499,725 (GRCm39) Q637L probably benign Het
Cdhr2 A T 13: 54,867,394 (GRCm39) M438L probably benign Het
Cep350 T C 1: 155,829,104 (GRCm39) I267V possibly damaging Het
Chrna5 A G 9: 54,911,926 (GRCm39) Y138C probably damaging Het
Chst3 T A 10: 60,021,525 (GRCm39) M441L probably benign Het
Cmya5 G A 13: 93,200,027 (GRCm39) P3434S probably benign Het
Cog2 T A 8: 125,252,422 (GRCm39) L42Q probably damaging Het
Cpq A T 15: 33,250,272 (GRCm39) I210F probably benign Het
Crnn C A 3: 93,055,765 (GRCm39) Q184K probably damaging Het
Csnka2ip A T 16: 64,298,422 (GRCm39) Y647* probably null Het
D5Ertd579e C T 5: 36,761,874 (GRCm39) R1331H probably benign Het
Dennd5a C T 7: 109,516,587 (GRCm39) probably null Het
Dync1h1 A G 12: 110,593,426 (GRCm39) Q1231R possibly damaging Het
Erbin T A 13: 103,970,239 (GRCm39) I1126F possibly damaging Het
Gcc1 A G 6: 28,421,110 (GRCm39) L69P possibly damaging Het
Gkn1 T C 6: 87,324,151 (GRCm39) Y119C probably damaging Het
Gmpr T G 13: 45,670,520 (GRCm39) W81G probably benign Het
Gyg1 T A 3: 20,192,215 (GRCm39) I236F probably benign Het
Hcrtr2 T C 9: 76,153,735 (GRCm39) Y219C probably damaging Het
Hmcn1 G A 1: 150,441,120 (GRCm39) Q5379* probably null Het
Kank1 T C 19: 25,388,681 (GRCm39) C785R probably benign Het
Lrp1b A T 2: 40,741,818 (GRCm39) C3036* probably null Het
Mdga2 T C 12: 66,736,109 (GRCm39) D373G probably damaging Het
Mgat2 A T 12: 69,232,493 (GRCm39) I356F probably benign Het
Miga2 A G 2: 30,268,009 (GRCm39) D346G probably damaging Het
Mprip T A 11: 59,651,084 (GRCm39) L1596Q possibly damaging Het
Mroh2b G A 15: 4,943,622 (GRCm39) R386Q probably benign Het
Mst1r T A 9: 107,797,179 (GRCm39) S1349R probably benign Het
Mtmr3 C T 11: 4,442,825 (GRCm39) R403H possibly damaging Het
Mycbpap G A 11: 94,398,969 (GRCm39) Q460* probably null Het
Myo9a T C 9: 59,775,464 (GRCm39) V1025A probably benign Het
Ncapd2 C T 6: 125,145,553 (GRCm39) E1365K probably null Het
Nkiras2 C A 11: 100,515,989 (GRCm39) D105E probably damaging Het
Nolc1 T G 19: 46,069,870 (GRCm39) probably null Het
Nos1 T C 5: 118,005,297 (GRCm39) F6L probably benign Het
Or10j3 A T 1: 173,030,938 (GRCm39) N5I probably damaging Het
Or12e1 G T 2: 87,022,081 (GRCm39) V17L probably benign Het
Or2t46 T C 11: 58,472,077 (GRCm39) Y136H probably damaging Het
Or2w1b C T 13: 21,300,735 (GRCm39) T291I probably benign Het
Or4f54 T A 2: 111,122,905 (GRCm39) C97* probably null Het
Or8b46 T A 9: 38,450,552 (GRCm39) Y120* probably null Het
Pfkm A G 15: 98,026,199 (GRCm39) E598G possibly damaging Het
Phf2 A T 13: 48,961,106 (GRCm39) D861E unknown Het
Polr2a A G 11: 69,630,703 (GRCm39) probably null Het
Popdc2 G A 16: 38,189,853 (GRCm39) V167M probably damaging Het
Ptpn22 T C 3: 103,793,114 (GRCm39) S422P probably benign Het
Rasa2 T C 9: 96,450,428 (GRCm39) K490R possibly damaging Het
Rbfox3 T A 11: 118,386,047 (GRCm39) D286V probably damaging Het
Rdh13 A G 7: 4,430,790 (GRCm39) W223R probably damaging Het
Riok3 T C 18: 12,261,986 (GRCm39) S7P probably benign Het
Rnaseh2b A G 14: 62,591,081 (GRCm39) E144G probably benign Het
Rnf20 C T 4: 49,651,498 (GRCm39) Q655* probably null Het
Rpap2 T C 5: 107,751,416 (GRCm39) Y8H probably damaging Het
Slc5a10 T C 11: 61,600,428 (GRCm39) Y181C probably benign Het
Snd1 G T 6: 28,888,252 (GRCm39) G896* probably null Het
Spast C T 17: 74,663,155 (GRCm39) Q158* probably null Het
Tas2r104 G A 6: 131,662,547 (GRCm39) S54F probably damaging Het
Tcaf2 C T 6: 42,604,951 (GRCm39) W611* probably null Het
Thoc2l C T 5: 104,668,376 (GRCm39) A966V probably benign Het
Timp4 G A 6: 115,227,364 (GRCm39) probably null Het
Tmem45a G A 16: 56,643,933 (GRCm39) S72L probably benign Het
Tnrc18 T C 5: 142,774,458 (GRCm39) T124A possibly damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Ttn T C 2: 76,773,259 (GRCm39) D2381G probably damaging Het
Uevld T C 7: 46,605,372 (GRCm39) T41A possibly damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Unc5d T C 8: 29,186,506 (GRCm39) E527G probably damaging Het
Vmn2r125 C T 4: 156,703,333 (GRCm39) T237I probably benign Het
Vmn2r63 A C 7: 42,583,038 (GRCm39) I59S probably benign Het
Vps72 G A 3: 95,026,006 (GRCm39) S106N probably benign Het
Zan A C 5: 137,407,931 (GRCm39) probably benign Het
Zbtb38 T C 9: 96,567,515 (GRCm39) K1190E probably benign Het
Zc3h6 T C 2: 128,859,278 (GRCm39) V1103A probably benign Het
Zfp407 G A 18: 84,580,282 (GRCm39) T277I probably damaging Het
Zfp804b A G 5: 6,819,509 (GRCm39) S1149P probably damaging Het
Other mutations in Fastkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Fastkd1 APN 2 69,537,893 (GRCm39) missense probably benign 0.02
IGL00702:Fastkd1 APN 2 69,538,889 (GRCm39) missense probably damaging 0.99
IGL00960:Fastkd1 APN 2 69,524,997 (GRCm39) splice site probably benign
IGL01154:Fastkd1 APN 2 69,520,404 (GRCm39) splice site probably null
IGL01463:Fastkd1 APN 2 69,520,405 (GRCm39) critical splice donor site probably null
IGL01913:Fastkd1 APN 2 69,538,845 (GRCm39) splice site probably benign
IGL01977:Fastkd1 APN 2 69,524,932 (GRCm39) missense possibly damaging 0.64
IGL02408:Fastkd1 APN 2 69,532,945 (GRCm39) missense probably benign
IGL02715:Fastkd1 APN 2 69,542,469 (GRCm39) critical splice donor site probably null
IGL03411:Fastkd1 APN 2 69,537,703 (GRCm39) missense probably damaging 0.99
PIT4519001:Fastkd1 UTSW 2 69,520,501 (GRCm39) missense probably damaging 0.97
R0541:Fastkd1 UTSW 2 69,532,750 (GRCm39) missense probably damaging 1.00
R0612:Fastkd1 UTSW 2 69,542,727 (GRCm39) missense probably benign 0.03
R1170:Fastkd1 UTSW 2 69,538,993 (GRCm39) splice site probably benign
R1499:Fastkd1 UTSW 2 69,538,982 (GRCm39) critical splice acceptor site probably null
R1586:Fastkd1 UTSW 2 69,542,492 (GRCm39) missense probably benign 0.43
R2172:Fastkd1 UTSW 2 69,530,477 (GRCm39) missense probably damaging 1.00
R2240:Fastkd1 UTSW 2 69,527,297 (GRCm39) missense probably benign 0.01
R2327:Fastkd1 UTSW 2 69,535,872 (GRCm39) nonsense probably null
R2897:Fastkd1 UTSW 2 69,532,960 (GRCm39) missense probably damaging 1.00
R4120:Fastkd1 UTSW 2 69,537,654 (GRCm39) missense probably damaging 0.98
R4544:Fastkd1 UTSW 2 69,542,655 (GRCm39) missense probably damaging 1.00
R4546:Fastkd1 UTSW 2 69,542,655 (GRCm39) missense probably damaging 1.00
R4798:Fastkd1 UTSW 2 69,521,651 (GRCm39) missense probably benign 0.38
R4993:Fastkd1 UTSW 2 69,533,084 (GRCm39) missense probably damaging 0.99
R5284:Fastkd1 UTSW 2 69,542,532 (GRCm39) missense probably benign 0.01
R5668:Fastkd1 UTSW 2 69,537,725 (GRCm39) missense possibly damaging 0.92
R6869:Fastkd1 UTSW 2 69,533,104 (GRCm39) missense probably benign 0.02
R6870:Fastkd1 UTSW 2 69,538,958 (GRCm39) missense probably benign 0.05
R7062:Fastkd1 UTSW 2 69,534,666 (GRCm39) missense possibly damaging 0.74
R7576:Fastkd1 UTSW 2 69,524,988 (GRCm39) missense probably damaging 1.00
R7644:Fastkd1 UTSW 2 69,527,184 (GRCm39) splice site probably null
R7971:Fastkd1 UTSW 2 69,537,703 (GRCm39) missense probably benign 0.19
R8336:Fastkd1 UTSW 2 69,542,489 (GRCm39) missense probably damaging 1.00
R8403:Fastkd1 UTSW 2 69,517,425 (GRCm39) nonsense probably null
R8422:Fastkd1 UTSW 2 69,532,778 (GRCm39) missense probably damaging 1.00
R9041:Fastkd1 UTSW 2 69,532,715 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTGAAGGACTAAAGGACCTCTC -3'
(R):5'- AAAACTAGATCAACTGGGCCGTCAC -3'

Sequencing Primer
(F):5'- caatcctcctgcttctgcc -3'
(R):5'- TCACCGGCTGCAACAGAG -3'
Posted On 2014-05-14