Incidental Mutation 'R1698:Vps72'
ID192383
Institutional Source Beutler Lab
Gene Symbol Vps72
Ensembl Gene ENSMUSG00000008958
Gene Namevacuolar protein sorting 72
SynonymsYL-1, Tcfl1
MMRRC Submission 039731-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1698 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95111022-95123051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95118695 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 106 (S106N)
Ref Sequence ENSEMBL: ENSMUSP00000009102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009102]
Predicted Effect probably benign
Transcript: ENSMUST00000009102
AA Change: S106N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000009102
Gene: ENSMUSG00000008958
AA Change: S106N

DomainStartEndE-ValueType
Pfam:YL1 5 216 5.1e-58 PFAM
low complexity region 247 264 N/A INTRINSIC
YL1_C 294 323 5.99e-9 SMART
low complexity region 335 358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152333
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a shared subunit of two multi-component complexes, the histone acetyltransferase complex TRRAP/TIP60 as well as the chromatin remodeling SRCAP-containing complex. The TRRAP/TIP60 complex acetylates nucleosomal histones important for transcriptional regulation, double strand DNA break repair and apoptosis. The SRCAP-containing complex catalyzes the exchange of histone H2A with the histone variant Htz1 (H2AFZ) into nucleosomes. This protein may be responsible for binding H2AFZ, which has a role in chromosome segregation. This protein may also have a role in regulating long-term hematopoietic stem cell activity. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,645,158 E340A possibly damaging Het
Abca13 A G 11: 9,314,507 D2963G probably benign Het
Actn3 T C 19: 4,862,207 D783G possibly damaging Het
Adamtsl2 A G 2: 27,103,127 E723G possibly damaging Het
Agrn G T 4: 156,166,558 Q1931K probably benign Het
Ankrd27 G A 7: 35,614,521 A426T probably benign Het
Atg9b C A 5: 24,388,188 G406C probably damaging Het
BC005561 C T 5: 104,520,510 A966V probably benign Het
C1ra A T 6: 124,522,766 Q637L probably benign Het
Cdhr2 A T 13: 54,719,581 M438L probably benign Het
Cep350 T C 1: 155,953,358 I267V possibly damaging Het
Chrna5 A G 9: 55,004,642 Y138C probably damaging Het
Chst3 T A 10: 60,185,703 M441L probably benign Het
Cmya5 G A 13: 93,063,519 P3434S probably benign Het
Cog2 T A 8: 124,525,683 L42Q probably damaging Het
Cpq A T 15: 33,250,126 I210F probably benign Het
Crnn C A 3: 93,148,458 Q184K probably damaging Het
Csnka2ip A T 16: 64,478,059 Y647* probably null Het
D5Ertd579e C T 5: 36,604,530 R1331H probably benign Het
Dennd5a C T 7: 109,917,380 probably null Het
Dync1h1 A G 12: 110,626,992 Q1231R possibly damaging Het
Erbin T A 13: 103,833,731 I1126F possibly damaging Het
Fastkd1 T C 2: 69,702,469 D518G probably benign Het
Gcc1 A G 6: 28,421,111 L69P possibly damaging Het
Gkn1 T C 6: 87,347,169 Y119C probably damaging Het
Gmpr T G 13: 45,517,044 W81G probably benign Het
Gyg T A 3: 20,138,051 I236F probably benign Het
Hcrtr2 T C 9: 76,246,453 Y219C probably damaging Het
Hmcn1 G A 1: 150,565,369 Q5379* probably null Het
Kank1 T C 19: 25,411,317 C785R probably benign Het
Lrp1b A T 2: 40,851,806 C3036* probably null Het
Mdga2 T C 12: 66,689,335 D373G probably damaging Het
Mgat2 A T 12: 69,185,719 I356F probably benign Het
Miga2 A G 2: 30,377,997 D346G probably damaging Het
Mprip T A 11: 59,760,258 L1596Q possibly damaging Het
Mroh2b G A 15: 4,914,140 R386Q probably benign Het
Mst1r T A 9: 107,919,980 S1349R probably benign Het
Mtmr3 C T 11: 4,492,825 R403H possibly damaging Het
Mycbpap G A 11: 94,508,143 Q460* probably null Het
Myo9a T C 9: 59,868,181 V1025A probably benign Het
Ncapd2 C T 6: 125,168,590 E1365K probably null Het
Nkiras2 C A 11: 100,625,163 D105E probably damaging Het
Nolc1 T G 19: 46,081,431 probably null Het
Nos1 T C 5: 117,867,232 F6L probably benign Het
Olfr1112 G T 2: 87,191,737 V17L probably benign Het
Olfr1278 T A 2: 111,292,560 C97* probably null Het
Olfr1369-ps1 C T 13: 21,116,565 T291I probably benign Het
Olfr218 A T 1: 173,203,371 N5I probably damaging Het
Olfr325 T C 11: 58,581,251 Y136H probably damaging Het
Olfr910 T A 9: 38,539,256 Y120* probably null Het
Pfkm A G 15: 98,128,318 E598G possibly damaging Het
Phf2 A T 13: 48,807,630 D861E unknown Het
Polr2a A G 11: 69,739,877 probably null Het
Popdc2 G A 16: 38,369,491 V167M probably damaging Het
Ptpn22 T C 3: 103,885,798 S422P probably benign Het
Rasa2 T C 9: 96,568,375 K490R possibly damaging Het
Rbfox3 T A 11: 118,495,221 D286V probably damaging Het
Rdh13 A G 7: 4,427,791 W223R probably damaging Het
Riok3 T C 18: 12,128,929 S7P probably benign Het
Rnaseh2b A G 14: 62,353,632 E144G probably benign Het
Rnf20 C T 4: 49,651,498 Q655* probably null Het
Rpap2 T C 5: 107,603,550 Y8H probably damaging Het
Slc5a10 T C 11: 61,709,602 Y181C probably benign Het
Snd1 G T 6: 28,888,253 G896* probably null Het
Spast C T 17: 74,356,160 Q158* probably null Het
Tas2r104 G A 6: 131,685,584 S54F probably damaging Het
Tcaf2 C T 6: 42,628,017 W611* probably null Het
Timp4 G A 6: 115,250,403 probably null Het
Tmem45a G A 16: 56,823,570 S72L probably benign Het
Tnrc18 T C 5: 142,788,703 T124A possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttn T C 2: 76,942,915 D2381G probably damaging Het
Uevld T C 7: 46,955,624 T41A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc5d T C 8: 28,696,478 E527G probably damaging Het
Vmn2r125 C T 4: 156,351,038 T237I probably benign Het
Vmn2r63 A C 7: 42,933,614 I59S probably benign Het
Zan A C 5: 137,409,669 probably benign Het
Zbtb38 T C 9: 96,685,462 K1190E probably benign Het
Zc3h6 T C 2: 129,017,358 V1103A probably benign Het
Zfp407 G A 18: 84,562,157 T277I probably damaging Het
Zfp804b A G 5: 6,769,509 S1149P probably damaging Het
Other mutations in Vps72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02051:Vps72 APN 3 95122729 missense possibly damaging 0.96
IGL02802:Vps72 UTSW 3 95119234 nonsense probably null
R0135:Vps72 UTSW 3 95119197 missense probably damaging 0.99
R0197:Vps72 UTSW 3 95122583 missense probably damaging 0.97
R0463:Vps72 UTSW 3 95121304 missense probably benign 0.41
R0883:Vps72 UTSW 3 95122583 missense probably damaging 0.97
R1101:Vps72 UTSW 3 95119176 missense probably damaging 1.00
R1484:Vps72 UTSW 3 95119151 missense probably damaging 1.00
R1839:Vps72 UTSW 3 95119218 missense possibly damaging 0.70
R1935:Vps72 UTSW 3 95122540 missense probably benign 0.01
R1936:Vps72 UTSW 3 95122540 missense probably benign 0.01
R3011:Vps72 UTSW 3 95119274 missense probably damaging 1.00
R4877:Vps72 UTSW 3 95118187 intron probably benign
Predicted Primers PCR Primer
(F):5'- AAGCGCAGAGTCGTCACCAAAG -3'
(R):5'- AGGGGTTAAAGTCACACATGCACAC -3'

Sequencing Primer
(F):5'- cctctgcccaccatgtc -3'
(R):5'- acatgcacacacatgcac -3'
Posted On2014-05-14