Incidental Mutation 'R1698:Ptpn22'
ID 192384
Institutional Source Beutler Lab
Gene Symbol Ptpn22
Ensembl Gene ENSMUSG00000027843
Gene Name protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Synonyms Ptpn8, 70zpep
MMRRC Submission 039731-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.845) question?
Stock # R1698 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 103767111-103819563 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103793114 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 422 (S422P)
Ref Sequence ENSEMBL: ENSMUSP00000029433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029433] [ENSMUST00000146071]
AlphaFold P29352
PDB Structure Solution structure of the SH3 domain from C-terminal Src Kinase complexed with a peptide from the tyrosine phosphatase PEP [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000029433
AA Change: S422P

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029433
Gene: ENSMUSG00000027843
AA Change: S422P

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
PTPc 23 291 3.32e-123 SMART
Blast:PTPc 305 502 2e-65 BLAST
PDB:1JEG|B 605 629 2e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134373
Predicted Effect probably benign
Transcript: ENSMUST00000146071
AA Change: S422P

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122307
Gene: ENSMUSG00000027843
AA Change: S422P

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
PTPc 23 291 3.32e-123 SMART
Blast:PTPc 305 502 9e-66 BLAST
internal_repeat_1 567 629 1.92e-7 PROSPERO
internal_repeat_1 651 705 1.92e-7 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198701
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes of member of the non-receptor class 4 subfamily of the protein-tyrosine phosphatase family. The encoded protein is a lymphoid-specific intracellular phosphatase that associates with the molecular adapter protein CBL and may be involved in regulating CBL function in the T-cell receptor signaling pathway. Mutations in this gene may be associated with a range of autoimmune disorders including Type 1 Diabetes, rheumatoid arthritis, systemic lupus erythematosus and Graves' disease. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice display antigen dependent increases in T cell proliferation and cytokine production, enlarged spleens and lymph nodes, increased spontaneous germinal center formation, increased B cell numbers, and increased serum IgG and IgE levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,622,117 (GRCm39) E340A possibly damaging Het
Abca13 A G 11: 9,264,507 (GRCm39) D2963G probably benign Het
Actn3 T C 19: 4,912,235 (GRCm39) D783G possibly damaging Het
Adamtsl2 A G 2: 26,993,139 (GRCm39) E723G possibly damaging Het
Agrn G T 4: 156,251,015 (GRCm39) Q1931K probably benign Het
Ankrd27 G A 7: 35,313,946 (GRCm39) A426T probably benign Het
Atg9b C A 5: 24,593,186 (GRCm39) G406C probably damaging Het
C1ra A T 6: 124,499,725 (GRCm39) Q637L probably benign Het
Cdhr2 A T 13: 54,867,394 (GRCm39) M438L probably benign Het
Cep350 T C 1: 155,829,104 (GRCm39) I267V possibly damaging Het
Chrna5 A G 9: 54,911,926 (GRCm39) Y138C probably damaging Het
Chst3 T A 10: 60,021,525 (GRCm39) M441L probably benign Het
Cmya5 G A 13: 93,200,027 (GRCm39) P3434S probably benign Het
Cog2 T A 8: 125,252,422 (GRCm39) L42Q probably damaging Het
Cpq A T 15: 33,250,272 (GRCm39) I210F probably benign Het
Crnn C A 3: 93,055,765 (GRCm39) Q184K probably damaging Het
Csnka2ip A T 16: 64,298,422 (GRCm39) Y647* probably null Het
D5Ertd579e C T 5: 36,761,874 (GRCm39) R1331H probably benign Het
Dennd5a C T 7: 109,516,587 (GRCm39) probably null Het
Dync1h1 A G 12: 110,593,426 (GRCm39) Q1231R possibly damaging Het
Erbin T A 13: 103,970,239 (GRCm39) I1126F possibly damaging Het
Fastkd1 T C 2: 69,532,813 (GRCm39) D518G probably benign Het
Gcc1 A G 6: 28,421,110 (GRCm39) L69P possibly damaging Het
Gkn1 T C 6: 87,324,151 (GRCm39) Y119C probably damaging Het
Gmpr T G 13: 45,670,520 (GRCm39) W81G probably benign Het
Gyg1 T A 3: 20,192,215 (GRCm39) I236F probably benign Het
Hcrtr2 T C 9: 76,153,735 (GRCm39) Y219C probably damaging Het
Hmcn1 G A 1: 150,441,120 (GRCm39) Q5379* probably null Het
Kank1 T C 19: 25,388,681 (GRCm39) C785R probably benign Het
Lrp1b A T 2: 40,741,818 (GRCm39) C3036* probably null Het
Mdga2 T C 12: 66,736,109 (GRCm39) D373G probably damaging Het
Mgat2 A T 12: 69,232,493 (GRCm39) I356F probably benign Het
Miga2 A G 2: 30,268,009 (GRCm39) D346G probably damaging Het
Mprip T A 11: 59,651,084 (GRCm39) L1596Q possibly damaging Het
Mroh2b G A 15: 4,943,622 (GRCm39) R386Q probably benign Het
Mst1r T A 9: 107,797,179 (GRCm39) S1349R probably benign Het
Mtmr3 C T 11: 4,442,825 (GRCm39) R403H possibly damaging Het
Mycbpap G A 11: 94,398,969 (GRCm39) Q460* probably null Het
Myo9a T C 9: 59,775,464 (GRCm39) V1025A probably benign Het
Ncapd2 C T 6: 125,145,553 (GRCm39) E1365K probably null Het
Nkiras2 C A 11: 100,515,989 (GRCm39) D105E probably damaging Het
Nolc1 T G 19: 46,069,870 (GRCm39) probably null Het
Nos1 T C 5: 118,005,297 (GRCm39) F6L probably benign Het
Or10j3 A T 1: 173,030,938 (GRCm39) N5I probably damaging Het
Or12e1 G T 2: 87,022,081 (GRCm39) V17L probably benign Het
Or2t46 T C 11: 58,472,077 (GRCm39) Y136H probably damaging Het
Or2w1b C T 13: 21,300,735 (GRCm39) T291I probably benign Het
Or4f54 T A 2: 111,122,905 (GRCm39) C97* probably null Het
Or8b46 T A 9: 38,450,552 (GRCm39) Y120* probably null Het
Pfkm A G 15: 98,026,199 (GRCm39) E598G possibly damaging Het
Phf2 A T 13: 48,961,106 (GRCm39) D861E unknown Het
Polr2a A G 11: 69,630,703 (GRCm39) probably null Het
Popdc2 G A 16: 38,189,853 (GRCm39) V167M probably damaging Het
Rasa2 T C 9: 96,450,428 (GRCm39) K490R possibly damaging Het
Rbfox3 T A 11: 118,386,047 (GRCm39) D286V probably damaging Het
Rdh13 A G 7: 4,430,790 (GRCm39) W223R probably damaging Het
Riok3 T C 18: 12,261,986 (GRCm39) S7P probably benign Het
Rnaseh2b A G 14: 62,591,081 (GRCm39) E144G probably benign Het
Rnf20 C T 4: 49,651,498 (GRCm39) Q655* probably null Het
Rpap2 T C 5: 107,751,416 (GRCm39) Y8H probably damaging Het
Slc5a10 T C 11: 61,600,428 (GRCm39) Y181C probably benign Het
Snd1 G T 6: 28,888,252 (GRCm39) G896* probably null Het
Spast C T 17: 74,663,155 (GRCm39) Q158* probably null Het
Tas2r104 G A 6: 131,662,547 (GRCm39) S54F probably damaging Het
Tcaf2 C T 6: 42,604,951 (GRCm39) W611* probably null Het
Thoc2l C T 5: 104,668,376 (GRCm39) A966V probably benign Het
Timp4 G A 6: 115,227,364 (GRCm39) probably null Het
Tmem45a G A 16: 56,643,933 (GRCm39) S72L probably benign Het
Tnrc18 T C 5: 142,774,458 (GRCm39) T124A possibly damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Ttn T C 2: 76,773,259 (GRCm39) D2381G probably damaging Het
Uevld T C 7: 46,605,372 (GRCm39) T41A possibly damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Unc5d T C 8: 29,186,506 (GRCm39) E527G probably damaging Het
Vmn2r125 C T 4: 156,703,333 (GRCm39) T237I probably benign Het
Vmn2r63 A C 7: 42,583,038 (GRCm39) I59S probably benign Het
Vps72 G A 3: 95,026,006 (GRCm39) S106N probably benign Het
Zan A C 5: 137,407,931 (GRCm39) probably benign Het
Zbtb38 T C 9: 96,567,515 (GRCm39) K1190E probably benign Het
Zc3h6 T C 2: 128,859,278 (GRCm39) V1103A probably benign Het
Zfp407 G A 18: 84,580,282 (GRCm39) T277I probably damaging Het
Zfp804b A G 5: 6,819,509 (GRCm39) S1149P probably damaging Het
Other mutations in Ptpn22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Ptpn22 APN 3 103,810,690 (GRCm39) missense probably benign 0.01
IGL01373:Ptpn22 APN 3 103,793,520 (GRCm39) missense probably damaging 0.99
IGL01943:Ptpn22 APN 3 103,793,652 (GRCm39) missense probably benign 0.02
IGL02092:Ptpn22 APN 3 103,784,637 (GRCm39) missense probably damaging 1.00
IGL02431:Ptpn22 APN 3 103,810,713 (GRCm39) missense probably benign 0.01
IGL02732:Ptpn22 APN 3 103,793,349 (GRCm39) missense probably damaging 0.98
IGL02738:Ptpn22 APN 3 103,781,382 (GRCm39) splice site probably benign
IGL03406:Ptpn22 APN 3 103,819,332 (GRCm39) missense probably benign 0.14
R0490:Ptpn22 UTSW 3 103,793,495 (GRCm39) missense probably damaging 1.00
R0494:Ptpn22 UTSW 3 103,767,771 (GRCm39) missense probably damaging 1.00
R0626:Ptpn22 UTSW 3 103,767,721 (GRCm39) start codon destroyed probably null 1.00
R0743:Ptpn22 UTSW 3 103,809,487 (GRCm39) missense probably damaging 1.00
R1441:Ptpn22 UTSW 3 103,781,563 (GRCm39) missense probably damaging 1.00
R1610:Ptpn22 UTSW 3 103,809,512 (GRCm39) splice site probably null
R1785:Ptpn22 UTSW 3 103,781,368 (GRCm39) missense probably damaging 0.99
R1786:Ptpn22 UTSW 3 103,781,368 (GRCm39) missense probably damaging 0.99
R1919:Ptpn22 UTSW 3 103,784,054 (GRCm39) critical splice donor site probably null
R2045:Ptpn22 UTSW 3 103,781,337 (GRCm39) missense possibly damaging 0.61
R3977:Ptpn22 UTSW 3 103,780,957 (GRCm39) splice site probably benign
R4176:Ptpn22 UTSW 3 103,793,561 (GRCm39) missense probably benign 0.00
R4478:Ptpn22 UTSW 3 103,809,380 (GRCm39) intron probably benign
R5093:Ptpn22 UTSW 3 103,789,418 (GRCm39) missense probably benign 0.39
R5579:Ptpn22 UTSW 3 103,789,455 (GRCm39) splice site probably null
R6022:Ptpn22 UTSW 3 103,793,421 (GRCm39) missense probably benign 0.00
R6110:Ptpn22 UTSW 3 103,819,331 (GRCm39) missense probably damaging 0.96
R6387:Ptpn22 UTSW 3 103,792,702 (GRCm39) missense probably benign 0.18
R7335:Ptpn22 UTSW 3 103,793,335 (GRCm39) missense probably damaging 0.97
R7516:Ptpn22 UTSW 3 103,792,854 (GRCm39) missense probably benign 0.16
R7523:Ptpn22 UTSW 3 103,819,331 (GRCm39) missense probably damaging 0.96
R7583:Ptpn22 UTSW 3 103,809,430 (GRCm39) missense probably benign 0.11
R8129:Ptpn22 UTSW 3 103,797,600 (GRCm39) critical splice donor site probably null
R8141:Ptpn22 UTSW 3 103,793,643 (GRCm39) missense possibly damaging 0.67
R9039:Ptpn22 UTSW 3 103,819,551 (GRCm39) unclassified probably benign
R9511:Ptpn22 UTSW 3 103,792,913 (GRCm39) missense probably benign 0.37
R9790:Ptpn22 UTSW 3 103,795,842 (GRCm39) missense possibly damaging 0.60
R9791:Ptpn22 UTSW 3 103,795,842 (GRCm39) missense possibly damaging 0.60
Z1177:Ptpn22 UTSW 3 103,793,016 (GRCm39) missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GCACTCGGCTAAATCAAGCCCTTC -3'
(R):5'- AGGCACCAGGCAGTGAATAATTCAG -3'

Sequencing Primer
(F):5'- GGCTAAATCAAGCCCTTCTTTTAAC -3'
(R):5'- GAAACATGGGCCACTCTTTG -3'
Posted On 2014-05-14