Incidental Mutation 'R1698:Nos1'
ID192394
Institutional Source Beutler Lab
Gene Symbol Nos1
Ensembl Gene ENSMUSG00000029361
Gene Namenitric oxide synthase 1, neuronal
SynonymsbNOS, nNOS, 2310005C01Rik, Nos-1, NO
MMRRC Submission 039731-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1698 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location117781032-117958840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117867232 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 6 (F6L)
Ref Sequence ENSEMBL: ENSMUSP00000127432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086451] [ENSMUST00000102557] [ENSMUST00000138579] [ENSMUST00000142742] [ENSMUST00000171055]
Predicted Effect probably benign
Transcript: ENSMUST00000086451
AA Change: F6L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000138506
Gene: ENSMUSG00000029361
AA Change: F6L

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 1e-226 PFAM
Pfam:Flavodoxin_1 757 930 3.5e-56 PFAM
Pfam:FAD_binding_1 985 1214 1.1e-84 PFAM
Pfam:NAD_binding_1 1246 1360 2.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102557
AA Change: F6L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000099617
Gene: ENSMUSG00000029361
AA Change: F6L

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 350 712 2e-196 PFAM
Pfam:Flavodoxin_1 757 964 2.3e-55 PFAM
Pfam:FAD_binding_1 1019 1248 2.9e-88 PFAM
Pfam:NAD_binding_1 1280 1394 2.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124194
Predicted Effect probably benign
Transcript: ENSMUST00000138579
AA Change: F6L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138176
Gene: ENSMUSG00000029361
AA Change: F6L

DomainStartEndE-ValueType
PDZ 26 80 1.26e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142742
AA Change: F6L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000120421
Gene: ENSMUSG00000029361
AA Change: F6L

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 4e-226 PFAM
Pfam:Flavodoxin_1 757 930 1.5e-55 PFAM
Pfam:FAD_binding_1 985 1214 3.2e-84 PFAM
Pfam:NAD_binding_1 1246 1360 1.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171055
AA Change: F6L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000127432
Gene: ENSMUSG00000029361
AA Change: F6L

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 4e-226 PFAM
Pfam:Flavodoxin_1 757 930 1.5e-55 PFAM
Pfam:FAD_binding_1 985 1214 3.2e-84 PFAM
Pfam:NAD_binding_1 1246 1360 1.4e-23 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of nitric oxide synthases, which synthesize nitric oxide from L-arginine. Nitric oxide is a reactive free radical, which acts as a biologic mediator in several processes, including neurotransmission, and antimicrobial and antitumoral activities. In the brain and peripheral nervous system, nitric oxide displays many properties of a neurotransmitter, and has been implicated in neurotoxicity associated with stroke and neurodegenerative diseases, neural regulation of smooth muscle, including peristalsis, and penile erection. This protein is ubiquitously expressed, with high level of expression in skeletal muscle. Multiple transcript variants that differ in the 5' UTR have been described for this gene but the full-length nature of these transcripts is not known. Additionally, alternatively spliced transcript variants encoding different isoforms (some testis-specific) have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice exhibit enlarged stomachs, abnormal pyloric and lower esophageal sphincters, age-related cardiac hypertrophy, altered alcohol consumption and responses, decreased ovulation and reduced REM sleep. Homozygous null mice display increased neurogenesis in the adult brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,645,158 E340A possibly damaging Het
Abca13 A G 11: 9,314,507 D2963G probably benign Het
Actn3 T C 19: 4,862,207 D783G possibly damaging Het
Adamtsl2 A G 2: 27,103,127 E723G possibly damaging Het
Agrn G T 4: 156,166,558 Q1931K probably benign Het
Ankrd27 G A 7: 35,614,521 A426T probably benign Het
Atg9b C A 5: 24,388,188 G406C probably damaging Het
BC005561 C T 5: 104,520,510 A966V probably benign Het
C1ra A T 6: 124,522,766 Q637L probably benign Het
Cdhr2 A T 13: 54,719,581 M438L probably benign Het
Cep350 T C 1: 155,953,358 I267V possibly damaging Het
Chrna5 A G 9: 55,004,642 Y138C probably damaging Het
Chst3 T A 10: 60,185,703 M441L probably benign Het
Cmya5 G A 13: 93,063,519 P3434S probably benign Het
Cog2 T A 8: 124,525,683 L42Q probably damaging Het
Cpq A T 15: 33,250,126 I210F probably benign Het
Crnn C A 3: 93,148,458 Q184K probably damaging Het
Csnka2ip A T 16: 64,478,059 Y647* probably null Het
D5Ertd579e C T 5: 36,604,530 R1331H probably benign Het
Dennd5a C T 7: 109,917,380 probably null Het
Dync1h1 A G 12: 110,626,992 Q1231R possibly damaging Het
Erbin T A 13: 103,833,731 I1126F possibly damaging Het
Fastkd1 T C 2: 69,702,469 D518G probably benign Het
Gcc1 A G 6: 28,421,111 L69P possibly damaging Het
Gkn1 T C 6: 87,347,169 Y119C probably damaging Het
Gmpr T G 13: 45,517,044 W81G probably benign Het
Gyg T A 3: 20,138,051 I236F probably benign Het
Hcrtr2 T C 9: 76,246,453 Y219C probably damaging Het
Hmcn1 G A 1: 150,565,369 Q5379* probably null Het
Kank1 T C 19: 25,411,317 C785R probably benign Het
Lrp1b A T 2: 40,851,806 C3036* probably null Het
Mdga2 T C 12: 66,689,335 D373G probably damaging Het
Mgat2 A T 12: 69,185,719 I356F probably benign Het
Miga2 A G 2: 30,377,997 D346G probably damaging Het
Mprip T A 11: 59,760,258 L1596Q possibly damaging Het
Mroh2b G A 15: 4,914,140 R386Q probably benign Het
Mst1r T A 9: 107,919,980 S1349R probably benign Het
Mtmr3 C T 11: 4,492,825 R403H possibly damaging Het
Mycbpap G A 11: 94,508,143 Q460* probably null Het
Myo9a T C 9: 59,868,181 V1025A probably benign Het
Ncapd2 C T 6: 125,168,590 E1365K probably null Het
Nkiras2 C A 11: 100,625,163 D105E probably damaging Het
Nolc1 T G 19: 46,081,431 probably null Het
Olfr1112 G T 2: 87,191,737 V17L probably benign Het
Olfr1278 T A 2: 111,292,560 C97* probably null Het
Olfr1369-ps1 C T 13: 21,116,565 T291I probably benign Het
Olfr218 A T 1: 173,203,371 N5I probably damaging Het
Olfr325 T C 11: 58,581,251 Y136H probably damaging Het
Olfr910 T A 9: 38,539,256 Y120* probably null Het
Pfkm A G 15: 98,128,318 E598G possibly damaging Het
Phf2 A T 13: 48,807,630 D861E unknown Het
Polr2a A G 11: 69,739,877 probably null Het
Popdc2 G A 16: 38,369,491 V167M probably damaging Het
Ptpn22 T C 3: 103,885,798 S422P probably benign Het
Rasa2 T C 9: 96,568,375 K490R possibly damaging Het
Rbfox3 T A 11: 118,495,221 D286V probably damaging Het
Rdh13 A G 7: 4,427,791 W223R probably damaging Het
Riok3 T C 18: 12,128,929 S7P probably benign Het
Rnaseh2b A G 14: 62,353,632 E144G probably benign Het
Rnf20 C T 4: 49,651,498 Q655* probably null Het
Rpap2 T C 5: 107,603,550 Y8H probably damaging Het
Slc5a10 T C 11: 61,709,602 Y181C probably benign Het
Snd1 G T 6: 28,888,253 G896* probably null Het
Spast C T 17: 74,356,160 Q158* probably null Het
Tas2r104 G A 6: 131,685,584 S54F probably damaging Het
Tcaf2 C T 6: 42,628,017 W611* probably null Het
Timp4 G A 6: 115,250,403 probably null Het
Tmem45a G A 16: 56,823,570 S72L probably benign Het
Tnrc18 T C 5: 142,788,703 T124A possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttn T C 2: 76,942,915 D2381G probably damaging Het
Uevld T C 7: 46,955,624 T41A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc5d T C 8: 28,696,478 E527G probably damaging Het
Vmn2r125 C T 4: 156,351,038 T237I probably benign Het
Vmn2r63 A C 7: 42,933,614 I59S probably benign Het
Vps72 G A 3: 95,118,695 S106N probably benign Het
Zan A C 5: 137,409,669 probably benign Het
Zbtb38 T C 9: 96,685,462 K1190E probably benign Het
Zc3h6 T C 2: 129,017,358 V1103A probably benign Het
Zfp407 G A 18: 84,562,157 T277I probably damaging Het
Zfp804b A G 5: 6,769,509 S1149P probably damaging Het
Other mutations in Nos1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nos1 APN 5 117910100 missense probably damaging 0.99
IGL01155:Nos1 APN 5 117945926 missense probably damaging 0.99
IGL01462:Nos1 APN 5 117867709 missense probably benign 0.10
IGL01464:Nos1 APN 5 117943192 missense probably damaging 1.00
IGL01620:Nos1 APN 5 117905309 critical splice acceptor site probably null
IGL01621:Nos1 APN 5 117945884 missense probably damaging 1.00
IGL01796:Nos1 APN 5 117938274 nonsense probably null
IGL02003:Nos1 APN 5 117905465 missense probably damaging 1.00
IGL02274:Nos1 APN 5 117897780 missense probably damaging 1.00
IGL02885:Nos1 APN 5 117895790 missense probably damaging 1.00
IGL02947:Nos1 APN 5 117943317 missense probably damaging 0.99
IGL03088:Nos1 APN 5 117867258 missense probably damaging 1.00
IGL03166:Nos1 APN 5 117914452 splice site probably benign
squanderer UTSW 5 117910238 missense probably damaging 0.97
R0007:Nos1 UTSW 5 117910088 missense probably damaging 1.00
R0012:Nos1 UTSW 5 117893902 missense probably damaging 1.00
R0080:Nos1 UTSW 5 117893878 missense probably damaging 1.00
R0212:Nos1 UTSW 5 117910212 missense possibly damaging 0.57
R0240:Nos1 UTSW 5 117867883 missense probably benign
R0240:Nos1 UTSW 5 117867883 missense probably benign
R0454:Nos1 UTSW 5 117943320 missense probably benign 0.00
R0494:Nos1 UTSW 5 117905474 missense probably damaging 1.00
R0882:Nos1 UTSW 5 117947447 missense probably damaging 1.00
R1099:Nos1 UTSW 5 117923395 missense probably damaging 0.96
R1243:Nos1 UTSW 5 117905472 missense probably damaging 1.00
R1387:Nos1 UTSW 5 117953783 splice site probably benign
R1432:Nos1 UTSW 5 117949619 splice site probably benign
R1710:Nos1 UTSW 5 117895919 missense probably damaging 1.00
R1859:Nos1 UTSW 5 117905462 missense possibly damaging 0.83
R1973:Nos1 UTSW 5 117936426 missense possibly damaging 0.52
R2084:Nos1 UTSW 5 117943245 missense probably damaging 1.00
R2112:Nos1 UTSW 5 117936571 missense probably benign 0.00
R4689:Nos1 UTSW 5 117879385 missense probably benign 0.04
R4769:Nos1 UTSW 5 117943245 nonsense probably null
R4893:Nos1 UTSW 5 117952877 missense possibly damaging 0.50
R4916:Nos1 UTSW 5 117947570 critical splice donor site probably null
R4956:Nos1 UTSW 5 117947510 missense probably benign
R4971:Nos1 UTSW 5 117943834 missense probably benign 0.05
R4987:Nos1 UTSW 5 117926533 critical splice donor site probably null
R5015:Nos1 UTSW 5 117867269 missense probably damaging 1.00
R5031:Nos1 UTSW 5 117879313 missense probably benign
R5137:Nos1 UTSW 5 117905313 missense probably benign 0.29
R5481:Nos1 UTSW 5 117867754 missense probably benign 0.06
R5541:Nos1 UTSW 5 117905394 missense probably damaging 1.00
R5655:Nos1 UTSW 5 117923257 missense probably damaging 1.00
R5866:Nos1 UTSW 5 117895902 missense probably damaging 0.97
R5934:Nos1 UTSW 5 117936445 missense probably damaging 0.99
R6158:Nos1 UTSW 5 117867574 missense probably benign 0.05
R6225:Nos1 UTSW 5 117912852 missense probably damaging 1.00
R6261:Nos1 UTSW 5 117936570 missense probably benign
R6388:Nos1 UTSW 5 117914436 missense possibly damaging 0.91
R6987:Nos1 UTSW 5 117895785 missense probably benign 0.05
R7104:Nos1 UTSW 5 117947431 missense probably damaging 1.00
R7136:Nos1 UTSW 5 117895860 missense possibly damaging 0.95
R7276:Nos1 UTSW 5 117910238 missense probably damaging 0.97
R7299:Nos1 UTSW 5 117867905 missense possibly damaging 0.89
R7301:Nos1 UTSW 5 117867905 missense possibly damaging 0.89
R7402:Nos1 UTSW 5 117949815 missense probably benign 0.34
R7408:Nos1 UTSW 5 117867518 missense probably damaging 1.00
R7618:Nos1 UTSW 5 117903944 missense probably benign 0.01
R7689:Nos1 UTSW 5 117897727 missense probably damaging 0.98
X0025:Nos1 UTSW 5 117943825 missense probably benign 0.00
X0026:Nos1 UTSW 5 117943152 missense probably damaging 1.00
Z1177:Nos1 UTSW 5 117923278 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCGGGAACACATGAAATCATGCC -3'
(R):5'- CAATGCCCCTGAGAACTTCCAGAG -3'

Sequencing Primer
(F):5'- TGAAATCATGCCACCCAAGG -3'
(R):5'- CTGTCATAGCTGAGGTCTACCAG -3'
Posted On2014-05-14