Incidental Mutation 'R1698:Zan'
ID 192395
Institutional Source Beutler Lab
Gene Symbol Zan
Ensembl Gene ENSMUSG00000079173
Gene Name zonadhesin
Synonyms Zan
MMRRC Submission 039731-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R1698 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 137376899-137475326 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) A to C at 137407931 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000117564] [ENSMUST00000164178]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000117564
AA Change: I3621S
SMART Domains Protein: ENSMUSP00000114068
Gene: ENSMUSG00000079173
AA Change: I3621S

signal peptide 1 17 N/A INTRINSIC
MAM 42 210 3.55e-20 SMART
MAM 214 374 3.97e-9 SMART
MAM 375 542 5.7e-42 SMART
low complexity region 549 563 N/A INTRINSIC
low complexity region 578 607 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
low complexity region 672 689 N/A INTRINSIC
low complexity region 702 779 N/A INTRINSIC
low complexity region 782 865 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 941 1038 N/A INTRINSIC
low complexity region 1043 1084 N/A INTRINSIC
low complexity region 1096 1131 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
low complexity region 1150 1167 N/A INTRINSIC
low complexity region 1178 1192 N/A INTRINSIC
EGF_like 1236 1259 7.09e1 SMART
VWC 1266 1356 5e-3 SMART
VWD 1316 1477 3.73e-36 SMART
C8 1521 1596 6.91e-23 SMART
EGF_like 1607 1647 6.41e1 SMART
VWC 1654 1745 1.08e-2 SMART
VWD 1703 1869 2.71e-47 SMART
C8 1908 1982 3.45e-32 SMART
Pfam:TIL 1985 2039 4.5e-13 PFAM
VWC 2041 2095 4.84e-1 SMART
FOLN 2074 2096 9.79e1 SMART
VWD 2088 2260 5.49e-25 SMART
C8 2307 2381 6.73e-3 SMART
Pfam:TIL 2384 2442 3e-12 PFAM
VWC 2444 2504 1.13e-1 SMART
FOLN 2475 2498 3.73e0 SMART
EGF_like 2512 2557 6.54e1 SMART
VWC 2564 2637 3.68e-2 SMART
FOLN 2595 2618 4.04e0 SMART
VWC 2684 2744 3.08e-1 SMART
FOLN 2715 2738 7.78e0 SMART
VWC 2804 2864 1.7e0 SMART
FOLN 2835 2858 2.58e1 SMART
VWC 2924 2984 4.74e-1 SMART
VWC 3044 3104 2.44e-1 SMART
VWC 3164 3237 7.57e-2 SMART
FOLN 3195 3218 2.25e1 SMART
VWC 3284 3344 4.22e-1 SMART
FOLN 3315 3338 2.1e0 SMART
VWC 3401 3461 7.67e-2 SMART
FOLN 3432 3455 4.39e0 SMART
VWC 3521 3581 8.45e-2 SMART
FOLN 3552 3575 1.27e1 SMART
VWC 3641 3714 3.51e-1 SMART
FOLN 3672 3695 2.16e0 SMART
VWC 3761 3821 9.7e-2 SMART
FOLN 3792 3815 1.27e1 SMART
VWC 3881 3954 1.83e-1 SMART
FOLN 3912 3933 1.17e1 SMART
VWC 3997 4050 3.61e-1 SMART
FOLN 4028 4051 1.84e0 SMART
EGF_like 4081 4126 5.79e1 SMART
VWC 4133 4210 4.03e-1 SMART
FOLN 4164 4187 7.99e0 SMART
VWC 4253 4308 3.21e-1 SMART
FOLN 4284 4302 8.54e1 SMART
VWC 4368 4428 2.74e-2 SMART
FOLN 4399 4422 7.46e1 SMART
VWC 4488 4548 6.37e-1 SMART
FOLN 4519 4542 1.04e0 SMART
VWC 4608 4681 4.47e-1 SMART
FOLN 4639 4662 2.22e0 SMART
VWC 4728 4781 1.12e0 SMART
FOLN 4759 4782 3.29e1 SMART
EGF 4800 4841 2.43e1 SMART
VWC 4848 4901 7.59e-1 SMART
FOLN 4879 4902 5.31e0 SMART
VWD 4899 5061 4.49e-30 SMART
low complexity region 5086 5102 N/A INTRINSIC
C8 5113 5191 8.25e-21 SMART
Pfam:TIL 5194 5247 1.9e-12 PFAM
VWC 5249 5307 1.22e0 SMART
EGF 5306 5339 3.15e-3 SMART
transmembrane domain 5356 5378 N/A INTRINSIC
low complexity region 5381 5399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150470
SMART Domains Protein: ENSMUSP00000114562
Gene: ENSMUSG00000079173

Pfam:TIL 1 54 1.9e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000164178
AA Change: I3621S
SMART Domains Protein: ENSMUSP00000132895
Gene: ENSMUSG00000079173
AA Change: I3621S

signal peptide 1 17 N/A INTRINSIC
MAM 42 210 3.55e-20 SMART
MAM 214 374 3.97e-9 SMART
MAM 375 542 5.7e-42 SMART
low complexity region 549 563 N/A INTRINSIC
low complexity region 578 607 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
low complexity region 672 689 N/A INTRINSIC
low complexity region 702 779 N/A INTRINSIC
low complexity region 782 865 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 941 1038 N/A INTRINSIC
low complexity region 1043 1084 N/A INTRINSIC
low complexity region 1096 1131 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
low complexity region 1150 1167 N/A INTRINSIC
low complexity region 1178 1192 N/A INTRINSIC
EGF_like 1236 1259 7.09e1 SMART
VWC 1266 1356 5e-3 SMART
VWD 1316 1477 3.73e-36 SMART
C8 1521 1596 6.91e-23 SMART
EGF_like 1607 1647 6.41e1 SMART
VWC 1654 1745 1.08e-2 SMART
VWD 1703 1869 2.71e-47 SMART
C8 1908 1982 3.45e-32 SMART
Pfam:TIL 1985 2039 2.3e-13 PFAM
VWC 2041 2095 4.84e-1 SMART
FOLN 2074 2096 9.79e1 SMART
VWD 2088 2260 5.49e-25 SMART
C8 2307 2381 6.73e-3 SMART
Pfam:TIL 2384 2442 6e-12 PFAM
VWC 2444 2504 1.13e-1 SMART
FOLN 2475 2498 3.73e0 SMART
EGF_like 2512 2557 6.54e1 SMART
VWC 2564 2637 3.68e-2 SMART
FOLN 2595 2618 4.04e0 SMART
VWC 2684 2744 3.08e-1 SMART
FOLN 2715 2738 7.78e0 SMART
VWC 2804 2864 1.7e0 SMART
FOLN 2835 2858 2.58e1 SMART
VWC 2924 2984 4.74e-1 SMART
VWC 3044 3104 2.44e-1 SMART
VWC 3164 3237 7.57e-2 SMART
FOLN 3195 3218 2.25e1 SMART
VWC 3284 3344 4.22e-1 SMART
FOLN 3315 3338 2.1e0 SMART
VWC 3401 3461 7.67e-2 SMART
FOLN 3432 3455 4.39e0 SMART
VWC 3521 3581 8.45e-2 SMART
FOLN 3552 3575 1.27e1 SMART
VWC 3641 3714 3.51e-1 SMART
FOLN 3672 3695 2.16e0 SMART
VWC 3761 3821 9.7e-2 SMART
FOLN 3792 3815 1.27e1 SMART
VWC 3881 3954 1.83e-1 SMART
FOLN 3912 3933 1.17e1 SMART
VWC 3997 4050 3.61e-1 SMART
FOLN 4028 4051 1.84e0 SMART
EGF_like 4081 4126 5.79e1 SMART
VWC 4133 4210 4.03e-1 SMART
FOLN 4164 4187 7.99e0 SMART
VWC 4253 4308 3.21e-1 SMART
FOLN 4284 4302 8.54e1 SMART
VWC 4368 4428 2.74e-2 SMART
FOLN 4399 4422 7.46e1 SMART
VWC 4488 4548 6.37e-1 SMART
FOLN 4519 4542 1.04e0 SMART
VWC 4608 4681 4.47e-1 SMART
FOLN 4639 4662 2.22e0 SMART
VWC 4728 4781 1.12e0 SMART
FOLN 4759 4782 3.29e1 SMART
EGF 4800 4841 2.43e1 SMART
VWC 4848 4901 7.59e-1 SMART
FOLN 4879 4902 5.31e0 SMART
VWD 4899 5061 4.49e-30 SMART
low complexity region 5086 5102 N/A INTRINSIC
C8 5113 5191 8.25e-21 SMART
Pfam:TIL 5194 5247 7.2e-13 PFAM
VWC 5249 5307 1.22e0 SMART
EGF 5306 5339 3.15e-3 SMART
transmembrane domain 5356 5378 N/A INTRINSIC
low complexity region 5381 5399 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the species specificity of sperm adhesion to the egg zona pellucida. The encoded protein is located in the acrosome and may be involved in signaling or gamete recognition. An allelic polymorphism in this gene results in both functional and frameshifted alleles; the reference genome represents the functional allele. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Sperm from mice homozygous for a knock-out allele exhibit decreased species-specific zona pellucida adhesion without alteration in fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,622,117 (GRCm39) E340A possibly damaging Het
Abca13 A G 11: 9,264,507 (GRCm39) D2963G probably benign Het
Actn3 T C 19: 4,912,235 (GRCm39) D783G possibly damaging Het
Adamtsl2 A G 2: 26,993,139 (GRCm39) E723G possibly damaging Het
Agrn G T 4: 156,251,015 (GRCm39) Q1931K probably benign Het
Ankrd27 G A 7: 35,313,946 (GRCm39) A426T probably benign Het
Atg9b C A 5: 24,593,186 (GRCm39) G406C probably damaging Het
C1ra A T 6: 124,499,725 (GRCm39) Q637L probably benign Het
Cdhr2 A T 13: 54,867,394 (GRCm39) M438L probably benign Het
Cep350 T C 1: 155,829,104 (GRCm39) I267V possibly damaging Het
Chrna5 A G 9: 54,911,926 (GRCm39) Y138C probably damaging Het
Chst3 T A 10: 60,021,525 (GRCm39) M441L probably benign Het
Cmya5 G A 13: 93,200,027 (GRCm39) P3434S probably benign Het
Cog2 T A 8: 125,252,422 (GRCm39) L42Q probably damaging Het
Cpq A T 15: 33,250,272 (GRCm39) I210F probably benign Het
Crnn C A 3: 93,055,765 (GRCm39) Q184K probably damaging Het
Csnka2ip A T 16: 64,298,422 (GRCm39) Y647* probably null Het
D5Ertd579e C T 5: 36,761,874 (GRCm39) R1331H probably benign Het
Dennd5a C T 7: 109,516,587 (GRCm39) probably null Het
Dync1h1 A G 12: 110,593,426 (GRCm39) Q1231R possibly damaging Het
Erbin T A 13: 103,970,239 (GRCm39) I1126F possibly damaging Het
Fastkd1 T C 2: 69,532,813 (GRCm39) D518G probably benign Het
Gcc1 A G 6: 28,421,110 (GRCm39) L69P possibly damaging Het
Gkn1 T C 6: 87,324,151 (GRCm39) Y119C probably damaging Het
Gmpr T G 13: 45,670,520 (GRCm39) W81G probably benign Het
Gyg1 T A 3: 20,192,215 (GRCm39) I236F probably benign Het
Hcrtr2 T C 9: 76,153,735 (GRCm39) Y219C probably damaging Het
Hmcn1 G A 1: 150,441,120 (GRCm39) Q5379* probably null Het
Kank1 T C 19: 25,388,681 (GRCm39) C785R probably benign Het
Lrp1b A T 2: 40,741,818 (GRCm39) C3036* probably null Het
Mdga2 T C 12: 66,736,109 (GRCm39) D373G probably damaging Het
Mgat2 A T 12: 69,232,493 (GRCm39) I356F probably benign Het
Miga2 A G 2: 30,268,009 (GRCm39) D346G probably damaging Het
Mprip T A 11: 59,651,084 (GRCm39) L1596Q possibly damaging Het
Mroh2b G A 15: 4,943,622 (GRCm39) R386Q probably benign Het
Mst1r T A 9: 107,797,179 (GRCm39) S1349R probably benign Het
Mtmr3 C T 11: 4,442,825 (GRCm39) R403H possibly damaging Het
Mycbpap G A 11: 94,398,969 (GRCm39) Q460* probably null Het
Myo9a T C 9: 59,775,464 (GRCm39) V1025A probably benign Het
Ncapd2 C T 6: 125,145,553 (GRCm39) E1365K probably null Het
Nkiras2 C A 11: 100,515,989 (GRCm39) D105E probably damaging Het
Nolc1 T G 19: 46,069,870 (GRCm39) probably null Het
Nos1 T C 5: 118,005,297 (GRCm39) F6L probably benign Het
Or10j3 A T 1: 173,030,938 (GRCm39) N5I probably damaging Het
Or12e1 G T 2: 87,022,081 (GRCm39) V17L probably benign Het
Or2t46 T C 11: 58,472,077 (GRCm39) Y136H probably damaging Het
Or2w1b C T 13: 21,300,735 (GRCm39) T291I probably benign Het
Or4f54 T A 2: 111,122,905 (GRCm39) C97* probably null Het
Or8b46 T A 9: 38,450,552 (GRCm39) Y120* probably null Het
Pfkm A G 15: 98,026,199 (GRCm39) E598G possibly damaging Het
Phf2 A T 13: 48,961,106 (GRCm39) D861E unknown Het
Polr2a A G 11: 69,630,703 (GRCm39) probably null Het
Popdc2 G A 16: 38,189,853 (GRCm39) V167M probably damaging Het
Ptpn22 T C 3: 103,793,114 (GRCm39) S422P probably benign Het
Rasa2 T C 9: 96,450,428 (GRCm39) K490R possibly damaging Het
Rbfox3 T A 11: 118,386,047 (GRCm39) D286V probably damaging Het
Rdh13 A G 7: 4,430,790 (GRCm39) W223R probably damaging Het
Riok3 T C 18: 12,261,986 (GRCm39) S7P probably benign Het
Rnaseh2b A G 14: 62,591,081 (GRCm39) E144G probably benign Het
Rnf20 C T 4: 49,651,498 (GRCm39) Q655* probably null Het
Rpap2 T C 5: 107,751,416 (GRCm39) Y8H probably damaging Het
Slc5a10 T C 11: 61,600,428 (GRCm39) Y181C probably benign Het
Snd1 G T 6: 28,888,252 (GRCm39) G896* probably null Het
Spast C T 17: 74,663,155 (GRCm39) Q158* probably null Het
Tas2r104 G A 6: 131,662,547 (GRCm39) S54F probably damaging Het
Tcaf2 C T 6: 42,604,951 (GRCm39) W611* probably null Het
Thoc2l C T 5: 104,668,376 (GRCm39) A966V probably benign Het
Timp4 G A 6: 115,227,364 (GRCm39) probably null Het
Tmem45a G A 16: 56,643,933 (GRCm39) S72L probably benign Het
Tnrc18 T C 5: 142,774,458 (GRCm39) T124A possibly damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Ttn T C 2: 76,773,259 (GRCm39) D2381G probably damaging Het
Uevld T C 7: 46,605,372 (GRCm39) T41A possibly damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Unc5d T C 8: 29,186,506 (GRCm39) E527G probably damaging Het
Vmn2r125 C T 4: 156,703,333 (GRCm39) T237I probably benign Het
Vmn2r63 A C 7: 42,583,038 (GRCm39) I59S probably benign Het
Vps72 G A 3: 95,026,006 (GRCm39) S106N probably benign Het
Zbtb38 T C 9: 96,567,515 (GRCm39) K1190E probably benign Het
Zc3h6 T C 2: 128,859,278 (GRCm39) V1103A probably benign Het
Zfp407 G A 18: 84,580,282 (GRCm39) T277I probably damaging Het
Zfp804b A G 5: 6,819,509 (GRCm39) S1149P probably damaging Het
Other mutations in Zan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Zan APN 5 137,386,082 (GRCm39) critical splice donor site probably null
IGL00158:Zan APN 5 137,452,519 (GRCm39) missense unknown
IGL00473:Zan APN 5 137,462,512 (GRCm39) missense possibly damaging 0.68
IGL00536:Zan APN 5 137,444,944 (GRCm39) missense unknown
IGL00567:Zan APN 5 137,414,539 (GRCm39) unclassified probably benign
IGL00820:Zan APN 5 137,384,626 (GRCm39) missense unknown
IGL00850:Zan APN 5 137,462,375 (GRCm39) missense unknown
IGL00906:Zan APN 5 137,387,622 (GRCm39) missense unknown
IGL00920:Zan APN 5 137,462,786 (GRCm39) missense unknown
IGL00964:Zan APN 5 137,404,203 (GRCm39) unclassified probably benign
IGL01356:Zan APN 5 137,434,694 (GRCm39) missense unknown
IGL01361:Zan APN 5 137,412,604 (GRCm39) unclassified probably benign
IGL01362:Zan APN 5 137,450,712 (GRCm39) missense unknown
IGL01411:Zan APN 5 137,387,155 (GRCm39) missense unknown
IGL01412:Zan APN 5 137,391,294 (GRCm39) missense unknown
IGL01531:Zan APN 5 137,422,874 (GRCm39) missense unknown
IGL01561:Zan APN 5 137,462,128 (GRCm39) missense unknown
IGL01564:Zan APN 5 137,444,995 (GRCm39) missense unknown
IGL01568:Zan APN 5 137,463,106 (GRCm39) missense unknown
IGL01719:Zan APN 5 137,393,916 (GRCm39) missense unknown
IGL01732:Zan APN 5 137,391,273 (GRCm39) missense unknown
IGL01761:Zan APN 5 137,423,859 (GRCm39) missense unknown
IGL01771:Zan APN 5 137,391,330 (GRCm39) missense unknown
IGL01810:Zan APN 5 137,461,888 (GRCm39) missense unknown
IGL01845:Zan APN 5 137,379,116 (GRCm39) unclassified probably benign
IGL01885:Zan APN 5 137,462,386 (GRCm39) missense unknown
IGL01992:Zan APN 5 137,422,368 (GRCm39) missense unknown
IGL02026:Zan APN 5 137,403,726 (GRCm39) unclassified probably benign
IGL02065:Zan APN 5 137,385,222 (GRCm39) nonsense probably null
IGL02133:Zan APN 5 137,409,760 (GRCm39) missense possibly damaging 0.84
IGL02274:Zan APN 5 137,419,429 (GRCm39) missense unknown
IGL02449:Zan APN 5 137,387,589 (GRCm39) missense unknown
IGL02456:Zan APN 5 137,445,106 (GRCm39) missense unknown
IGL02493:Zan APN 5 137,433,968 (GRCm39) missense unknown
IGL02496:Zan APN 5 137,463,056 (GRCm39) nonsense probably null
IGL02528:Zan APN 5 137,463,403 (GRCm39) missense possibly damaging 0.83
IGL02550:Zan APN 5 137,385,301 (GRCm39) missense unknown
IGL02598:Zan APN 5 137,444,473 (GRCm39) missense unknown
IGL02697:Zan APN 5 137,398,810 (GRCm39) missense unknown
IGL02933:Zan APN 5 137,426,676 (GRCm39) missense unknown
IGL02963:Zan APN 5 137,454,512 (GRCm39) missense unknown
IGL02972:Zan APN 5 137,461,948 (GRCm39) missense unknown
IGL03068:Zan APN 5 137,474,677 (GRCm39) missense probably damaging 1.00
IGL03104:Zan APN 5 137,461,762 (GRCm39) missense unknown
IGL03110:Zan APN 5 137,418,278 (GRCm39) missense unknown
IGL03156:Zan APN 5 137,462,201 (GRCm39) missense unknown
IGL03302:Zan APN 5 137,466,652 (GRCm39) missense possibly damaging 0.93
IGL03307:Zan APN 5 137,472,287 (GRCm39) missense probably damaging 0.99
IGL03340:Zan APN 5 137,426,136 (GRCm39) missense unknown
IGL03379:Zan APN 5 137,462,477 (GRCm39) missense unknown
IGL03405:Zan APN 5 137,422,859 (GRCm39) missense unknown
Befallen UTSW 5 137,410,938 (GRCm39) unclassified probably benign
befell UTSW 5 137,444,299 (GRCm39) splice site probably null
R3853_zan_008 UTSW 5 137,472,326 (GRCm39) missense probably damaging 1.00
BB010:Zan UTSW 5 137,461,841 (GRCm39) missense unknown
BB020:Zan UTSW 5 137,461,841 (GRCm39) missense unknown
G1patch:Zan UTSW 5 137,436,782 (GRCm39) missense unknown
PIT4283001:Zan UTSW 5 137,398,355 (GRCm39) missense unknown
PIT4431001:Zan UTSW 5 137,390,326 (GRCm39) missense unknown
PIT4498001:Zan UTSW 5 137,415,298 (GRCm39) critical splice donor site probably null
R0027:Zan UTSW 5 137,404,781 (GRCm39) unclassified probably benign
R0047:Zan UTSW 5 137,401,918 (GRCm39) missense unknown
R0149:Zan UTSW 5 137,395,028 (GRCm39) missense unknown
R0240:Zan UTSW 5 137,396,624 (GRCm39) missense unknown
R0240:Zan UTSW 5 137,396,624 (GRCm39) missense unknown
R0241:Zan UTSW 5 137,420,084 (GRCm39) missense unknown
R0241:Zan UTSW 5 137,420,084 (GRCm39) missense unknown
R0361:Zan UTSW 5 137,395,028 (GRCm39) missense unknown
R0432:Zan UTSW 5 137,380,578 (GRCm39) unclassified probably benign
R0436:Zan UTSW 5 137,463,164 (GRCm39) missense unknown
R0446:Zan UTSW 5 137,389,920 (GRCm39) missense unknown
R0457:Zan UTSW 5 137,405,968 (GRCm39) unclassified probably benign
R0478:Zan UTSW 5 137,398,788 (GRCm39) splice site probably benign
R0487:Zan UTSW 5 137,411,620 (GRCm39) critical splice donor site probably null
R0497:Zan UTSW 5 137,410,938 (GRCm39) unclassified probably benign
R0504:Zan UTSW 5 137,468,580 (GRCm39) missense probably damaging 1.00
R0545:Zan UTSW 5 137,394,439 (GRCm39) missense unknown
R0556:Zan UTSW 5 137,452,482 (GRCm39) missense unknown
R0615:Zan UTSW 5 137,466,693 (GRCm39) missense probably damaging 1.00
R0737:Zan UTSW 5 137,387,511 (GRCm39) missense unknown
R0835:Zan UTSW 5 137,406,659 (GRCm39) unclassified probably benign
R0863:Zan UTSW 5 137,456,901 (GRCm39) missense unknown
R0971:Zan UTSW 5 137,432,325 (GRCm39) missense unknown
R1327:Zan UTSW 5 137,464,173 (GRCm39) splice site probably benign
R1338:Zan UTSW 5 137,391,913 (GRCm39) nonsense probably null
R1413:Zan UTSW 5 137,426,201 (GRCm39) missense unknown
R1446:Zan UTSW 5 137,387,622 (GRCm39) missense unknown
R1464:Zan UTSW 5 137,418,191 (GRCm39) missense unknown
R1464:Zan UTSW 5 137,418,191 (GRCm39) missense unknown
R1561:Zan UTSW 5 137,379,100 (GRCm39) nonsense probably null
R1569:Zan UTSW 5 137,427,392 (GRCm39) missense unknown
R1575:Zan UTSW 5 137,460,214 (GRCm39) missense unknown
R1618:Zan UTSW 5 137,382,092 (GRCm39) missense unknown
R1634:Zan UTSW 5 137,411,052 (GRCm39) unclassified probably benign
R1650:Zan UTSW 5 137,392,863 (GRCm39) splice site probably benign
R1680:Zan UTSW 5 137,401,312 (GRCm39) missense unknown
R1704:Zan UTSW 5 137,432,264 (GRCm39) nonsense probably null
R1728:Zan UTSW 5 137,413,280 (GRCm39) unclassified probably benign
R1729:Zan UTSW 5 137,413,280 (GRCm39) unclassified probably benign
R1769:Zan UTSW 5 137,462,780 (GRCm39) missense unknown
R1774:Zan UTSW 5 137,418,251 (GRCm39) missense unknown
R1800:Zan UTSW 5 137,384,713 (GRCm39) missense unknown
R1858:Zan UTSW 5 137,404,139 (GRCm39) unclassified probably benign
R1888:Zan UTSW 5 137,387,590 (GRCm39) missense unknown
R1888:Zan UTSW 5 137,387,590 (GRCm39) missense unknown
R1925:Zan UTSW 5 137,423,904 (GRCm39) missense unknown
R1938:Zan UTSW 5 137,387,201 (GRCm39) missense unknown
R1955:Zan UTSW 5 137,387,545 (GRCm39) missense unknown
R1989:Zan UTSW 5 137,418,268 (GRCm39) nonsense probably null
R1997:Zan UTSW 5 137,401,376 (GRCm39) nonsense probably null
R2008:Zan UTSW 5 137,450,712 (GRCm39) missense unknown
R2035:Zan UTSW 5 137,442,209 (GRCm39) missense unknown
R2153:Zan UTSW 5 137,434,662 (GRCm39) missense unknown
R2154:Zan UTSW 5 137,412,511 (GRCm39) unclassified probably benign
R2176:Zan UTSW 5 137,420,110 (GRCm39) missense unknown
R2217:Zan UTSW 5 137,408,568 (GRCm39) utr 3 prime probably benign
R2218:Zan UTSW 5 137,408,568 (GRCm39) utr 3 prime probably benign
R2237:Zan UTSW 5 137,456,099 (GRCm39) nonsense probably null
R2239:Zan UTSW 5 137,456,099 (GRCm39) nonsense probably null
R2346:Zan UTSW 5 137,420,129 (GRCm39) missense unknown
R2360:Zan UTSW 5 137,394,388 (GRCm39) missense unknown
R2389:Zan UTSW 5 137,474,642 (GRCm39) critical splice donor site probably null
R2412:Zan UTSW 5 137,412,425 (GRCm39) splice site probably null
R2426:Zan UTSW 5 137,387,254 (GRCm39) missense unknown
R2435:Zan UTSW 5 137,436,836 (GRCm39) missense unknown
R2509:Zan UTSW 5 137,454,848 (GRCm39) missense unknown
R3416:Zan UTSW 5 137,433,982 (GRCm39) missense unknown
R3691:Zan UTSW 5 137,418,281 (GRCm39) missense unknown
R3853:Zan UTSW 5 137,472,326 (GRCm39) missense probably damaging 1.00
R4006:Zan UTSW 5 137,462,201 (GRCm39) missense unknown
R4007:Zan UTSW 5 137,462,201 (GRCm39) missense unknown
R4033:Zan UTSW 5 137,436,122 (GRCm39) nonsense probably null
R4059:Zan UTSW 5 137,435,082 (GRCm39) missense unknown
R4109:Zan UTSW 5 137,456,881 (GRCm39) missense unknown
R4194:Zan UTSW 5 137,461,817 (GRCm39) missense unknown
R4226:Zan UTSW 5 137,422,240 (GRCm39) missense unknown
R4457:Zan UTSW 5 137,409,778 (GRCm39) missense unknown
R4544:Zan UTSW 5 137,382,096 (GRCm39) missense unknown
R4546:Zan UTSW 5 137,382,096 (GRCm39) missense unknown
R4642:Zan UTSW 5 137,462,450 (GRCm39) missense unknown
R4708:Zan UTSW 5 137,444,974 (GRCm39) missense unknown
R4773:Zan UTSW 5 137,434,575 (GRCm39) splice site probably benign
R4774:Zan UTSW 5 137,387,281 (GRCm39) missense unknown
R4788:Zan UTSW 5 137,440,375 (GRCm39) missense unknown
R4795:Zan UTSW 5 137,379,112 (GRCm39) nonsense probably null
R4796:Zan UTSW 5 137,379,112 (GRCm39) nonsense probably null
R4812:Zan UTSW 5 137,454,547 (GRCm39) missense unknown
R4832:Zan UTSW 5 137,391,423 (GRCm39) missense unknown
R4882:Zan UTSW 5 137,436,710 (GRCm39) missense unknown
R4896:Zan UTSW 5 137,384,718 (GRCm39) missense unknown
R4921:Zan UTSW 5 137,406,632 (GRCm39) unclassified probably benign
R4943:Zan UTSW 5 137,456,152 (GRCm39) missense unknown
R4978:Zan UTSW 5 137,405,183 (GRCm39) unclassified probably benign
R5013:Zan UTSW 5 137,382,099 (GRCm39) missense unknown
R5024:Zan UTSW 5 137,460,155 (GRCm39) nonsense probably null
R5230:Zan UTSW 5 137,452,340 (GRCm39) missense unknown
R5354:Zan UTSW 5 137,379,050 (GRCm39) unclassified probably benign
R5380:Zan UTSW 5 137,456,102 (GRCm39) missense unknown
R5394:Zan UTSW 5 137,462,336 (GRCm39) missense unknown
R5394:Zan UTSW 5 137,433,896 (GRCm39) missense unknown
R5435:Zan UTSW 5 137,402,024 (GRCm39) missense unknown
R5441:Zan UTSW 5 137,435,013 (GRCm39) missense unknown
R5447:Zan UTSW 5 137,470,453 (GRCm39) missense probably damaging 1.00
R5455:Zan UTSW 5 137,452,262 (GRCm39) missense unknown
R5495:Zan UTSW 5 137,468,670 (GRCm39) missense probably damaging 1.00
R5496:Zan UTSW 5 137,434,607 (GRCm39) missense unknown
R5523:Zan UTSW 5 137,420,155 (GRCm39) missense unknown
R5534:Zan UTSW 5 137,436,713 (GRCm39) missense unknown
R5572:Zan UTSW 5 137,392,693 (GRCm39) missense unknown
R5576:Zan UTSW 5 137,426,744 (GRCm39) nonsense probably null
R5587:Zan UTSW 5 137,390,024 (GRCm39) missense unknown
R5593:Zan UTSW 5 137,466,600 (GRCm39) missense possibly damaging 0.72
R5600:Zan UTSW 5 137,385,233 (GRCm39) missense unknown
R5682:Zan UTSW 5 137,412,521 (GRCm39) nonsense probably null
R5712:Zan UTSW 5 137,398,360 (GRCm39) missense unknown
R5751:Zan UTSW 5 137,408,423 (GRCm39) splice site probably null
R5782:Zan UTSW 5 137,418,269 (GRCm39) missense unknown
R5835:Zan UTSW 5 137,454,917 (GRCm39) missense unknown
R5846:Zan UTSW 5 137,392,638 (GRCm39) splice site probably null
R5903:Zan UTSW 5 137,440,396 (GRCm39) missense unknown
R5911:Zan UTSW 5 137,456,174 (GRCm39) missense unknown
R5935:Zan UTSW 5 137,442,192 (GRCm39) missense unknown
R5985:Zan UTSW 5 137,444,299 (GRCm39) splice site probably null
R5995:Zan UTSW 5 137,377,071 (GRCm39) unclassified probably benign
R6012:Zan UTSW 5 137,462,791 (GRCm39) missense unknown
R6077:Zan UTSW 5 137,412,559 (GRCm39) unclassified probably benign
R6227:Zan UTSW 5 137,466,605 (GRCm39) missense probably damaging 0.96
R6262:Zan UTSW 5 137,427,747 (GRCm39) splice site probably null
R6337:Zan UTSW 5 137,450,750 (GRCm39) missense unknown
R6598:Zan UTSW 5 137,404,626 (GRCm39) unclassified probably benign
R6725:Zan UTSW 5 137,436,782 (GRCm39) missense unknown
R6765:Zan UTSW 5 137,391,409 (GRCm39) missense unknown
R6820:Zan UTSW 5 137,406,106 (GRCm39) unclassified probably benign
R6829:Zan UTSW 5 137,414,540 (GRCm39) unclassified probably benign
R6851:Zan UTSW 5 137,394,453 (GRCm39) missense unknown
R6903:Zan UTSW 5 137,454,566 (GRCm39) missense unknown
R6910:Zan UTSW 5 137,417,342 (GRCm39) missense unknown
R6968:Zan UTSW 5 137,460,075 (GRCm39) missense unknown
R7021:Zan UTSW 5 137,422,213 (GRCm39) missense unknown
R7039:Zan UTSW 5 137,398,396 (GRCm39) missense unknown
R7101:Zan UTSW 5 137,396,552 (GRCm39) missense unknown
R7102:Zan UTSW 5 137,452,462 (GRCm39) critical splice donor site probably null
R7155:Zan UTSW 5 137,460,106 (GRCm39) missense unknown
R7158:Zan UTSW 5 137,398,906 (GRCm39) missense unknown
R7170:Zan UTSW 5 137,461,756 (GRCm39) missense unknown
R7203:Zan UTSW 5 137,432,358 (GRCm39) missense unknown
R7204:Zan UTSW 5 137,426,240 (GRCm39) missense unknown
R7305:Zan UTSW 5 137,413,401 (GRCm39) missense unknown
R7327:Zan UTSW 5 137,463,494 (GRCm39) missense probably benign 0.35
R7340:Zan UTSW 5 137,382,092 (GRCm39) missense unknown
R7360:Zan UTSW 5 137,385,232 (GRCm39) missense unknown
R7385:Zan UTSW 5 137,432,416 (GRCm39) nonsense probably null
R7385:Zan UTSW 5 137,448,753 (GRCm39) missense unknown
R7438:Zan UTSW 5 137,423,824 (GRCm39) missense unknown
R7453:Zan UTSW 5 137,464,264 (GRCm39) missense probably damaging 1.00
R7483:Zan UTSW 5 137,445,057 (GRCm39) missense unknown
R7499:Zan UTSW 5 137,462,618 (GRCm39) missense probably benign 0.23
R7566:Zan UTSW 5 137,410,845 (GRCm39) critical splice donor site probably null
R7641:Zan UTSW 5 137,465,370 (GRCm39) missense possibly damaging 0.74
R7674:Zan UTSW 5 137,465,370 (GRCm39) missense possibly damaging 0.74
R7678:Zan UTSW 5 137,461,802 (GRCm39) missense unknown
R7785:Zan UTSW 5 137,427,405 (GRCm39) missense unknown
R7814:Zan UTSW 5 137,461,841 (GRCm39) missense unknown
R7841:Zan UTSW 5 137,435,064 (GRCm39) missense unknown
R7861:Zan UTSW 5 137,405,295 (GRCm39) missense unknown
R7869:Zan UTSW 5 137,471,863 (GRCm39) missense probably damaging 1.00
R7933:Zan UTSW 5 137,461,841 (GRCm39) missense unknown
R7934:Zan UTSW 5 137,461,841 (GRCm39) missense unknown
R7935:Zan UTSW 5 137,461,841 (GRCm39) missense unknown
R7960:Zan UTSW 5 137,463,154 (GRCm39) missense unknown
R7960:Zan UTSW 5 137,407,865 (GRCm39) missense unknown
R7990:Zan UTSW 5 137,391,352 (GRCm39) missense unknown
R8008:Zan UTSW 5 137,403,624 (GRCm39) missense unknown
R8025:Zan UTSW 5 137,404,614 (GRCm39) missense unknown
R8061:Zan UTSW 5 137,434,893 (GRCm39) missense unknown
R8190:Zan UTSW 5 137,465,346 (GRCm39) missense probably damaging 1.00
R8202:Zan UTSW 5 137,387,589 (GRCm39) missense unknown
R8302:Zan UTSW 5 137,407,923 (GRCm39) missense unknown
R8305:Zan UTSW 5 137,448,813 (GRCm39) missense unknown
R8328:Zan UTSW 5 137,392,726 (GRCm39) missense unknown
R8377:Zan UTSW 5 137,389,949 (GRCm39) missense unknown
R8404:Zan UTSW 5 137,396,594 (GRCm39) missense unknown
R8502:Zan UTSW 5 137,471,845 (GRCm39) missense probably damaging 1.00
R8510:Zan UTSW 5 137,387,200 (GRCm39) missense unknown
R8511:Zan UTSW 5 137,445,108 (GRCm39) missense unknown
R8527:Zan UTSW 5 137,433,971 (GRCm39) missense unknown
R8695:Zan UTSW 5 137,385,217 (GRCm39) missense unknown
R8708:Zan UTSW 5 137,461,539 (GRCm39) critical splice donor site probably null
R8744:Zan UTSW 5 137,426,126 (GRCm39) missense unknown
R8795:Zan UTSW 5 137,396,522 (GRCm39) missense unknown
R8841:Zan UTSW 5 137,454,936 (GRCm39) missense unknown
R8862:Zan UTSW 5 137,472,674 (GRCm39) missense probably benign 0.28
R8937:Zan UTSW 5 137,393,888 (GRCm39) missense unknown
R8973:Zan UTSW 5 137,387,578 (GRCm39) missense unknown
R8988:Zan UTSW 5 137,406,563 (GRCm39) missense unknown
R8995:Zan UTSW 5 137,393,882 (GRCm39) missense unknown
R9036:Zan UTSW 5 137,464,206 (GRCm39) missense probably damaging 1.00
R9037:Zan UTSW 5 137,452,578 (GRCm39) missense unknown
R9061:Zan UTSW 5 137,462,653 (GRCm39) missense probably damaging 0.98
R9077:Zan UTSW 5 137,401,468 (GRCm39) missense unknown
R9164:Zan UTSW 5 137,422,333 (GRCm39) missense unknown
R9186:Zan UTSW 5 137,391,810 (GRCm39) missense unknown
R9222:Zan UTSW 5 137,465,463 (GRCm39) missense possibly damaging 0.56
R9224:Zan UTSW 5 137,472,269 (GRCm39) missense probably damaging 1.00
R9277:Zan UTSW 5 137,462,254 (GRCm39) missense unknown
R9296:Zan UTSW 5 137,387,138 (GRCm39) missense unknown
R9300:Zan UTSW 5 137,468,519 (GRCm39) critical splice donor site probably null
R9352:Zan UTSW 5 137,434,745 (GRCm39) missense unknown
R9382:Zan UTSW 5 137,389,917 (GRCm39) missense unknown
R9393:Zan UTSW 5 137,403,682 (GRCm39) missense unknown
R9534:Zan UTSW 5 137,407,945 (GRCm39) nonsense probably null
R9548:Zan UTSW 5 137,401,323 (GRCm39) missense unknown
R9564:Zan UTSW 5 137,404,688 (GRCm39) missense unknown
R9623:Zan UTSW 5 137,461,636 (GRCm39) missense unknown
R9643:Zan UTSW 5 137,456,812 (GRCm39) missense unknown
R9648:Zan UTSW 5 137,405,992 (GRCm39) missense unknown
R9663:Zan UTSW 5 137,379,119 (GRCm39) missense unknown
R9683:Zan UTSW 5 137,462,776 (GRCm39) missense unknown
R9688:Zan UTSW 5 137,466,717 (GRCm39) missense probably damaging 1.00
R9700:Zan UTSW 5 137,454,836 (GRCm39) missense unknown
R9715:Zan UTSW 5 137,398,817 (GRCm39) missense unknown
R9722:Zan UTSW 5 137,387,324 (GRCm39) missense unknown
RF013:Zan UTSW 5 137,389,982 (GRCm39) missense unknown
X0062:Zan UTSW 5 137,444,500 (GRCm39) missense unknown
X0066:Zan UTSW 5 137,462,692 (GRCm39) missense probably benign 0.00
Z1176:Zan UTSW 5 137,409,850 (GRCm39) missense unknown
Z1176:Zan UTSW 5 137,396,624 (GRCm39) missense unknown
Z1176:Zan UTSW 5 137,391,859 (GRCm39) missense unknown
Z1177:Zan UTSW 5 137,391,367 (GRCm39) missense unknown
Z1177:Zan UTSW 5 137,387,323 (GRCm39) missense unknown
Z1177:Zan UTSW 5 137,381,995 (GRCm39) missense unknown
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tctgctgtctgcctttcc -3'
(R):5'- cttctctcaaagcttggcac -3'
Posted On 2014-05-14