Mutagenetix > Incidental Mutations

Incidental Mutation 'R1698:Snd1'

192399

Institutional Source

Beutler Lab

Gene Symbol

Snd1

Ensembl Gene

ENSMUSG00000001424

Gene Name

staphylococcal nuclease and tudor domain containing 1

Synonyms

p100 co-activator, Tudor-SN

MMRRC Submission

039731-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.896) question?

Stock #

R1698 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

28475139-28935162 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 28888253 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Stop codon at position 896 (G896*)

Ref Sequence

ENSEMBL: ENSMUSP00000001460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001460] [ENSMUST00000167201]

AlphaFold

Q78PY7

Predicted Effect

probably null
Transcript: ENSMUST00000001460
AA Change: G896*

SMART Domains

Protein: ENSMUSP00000001460
Gene: ENSMUSG00000001424
AA Change: G896*

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
SNc	18	166	7.12e-54	SMART
SNc	193	328	8.37e-51	SMART
SNc	341	496	4.11e-59	SMART
SNc	525	660	3.82e-45	SMART
TUDOR	728	785	4.8e-19	SMART
Pfam:SNase	835	895	1.3e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165151

Predicted Effect

probably benign
Transcript: ENSMUST00000167201

SMART Domains

Protein: ENSMUSP00000128737
Gene: ENSMUSG00000001424

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
SNc	18	166	7.12e-54	SMART
SNc	193	328	8.37e-51	SMART
SNc	341	496	4.11e-59	SMART
SCOP:d1sty__	526	592	1e-4	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional co-activator that interacts with the acidic domain of Epstein-Barr virus nuclear antigen 2 (EBNA 2), a transcriptional activator that is required for B-lymphocyte transformation. Other transcription factors that interact with this protein are signal transducers and activators of transcription, STATs. This protein is also thought to be essential for normal cell growth. A similar protein in mammals and other organisms is a component of the RNA-induced silencing complex (RISC). [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	C	6: 121,645,158	E340A	possibly damaging	Het
Abca13	A	G	11: 9,314,507	D2963G	probably benign	Het
Actn3	T	C	19: 4,862,207	D783G	possibly damaging	Het
Adamtsl2	A	G	2: 27,103,127	E723G	possibly damaging	Het
Agrn	G	T	4: 156,166,558	Q1931K	probably benign	Het
Ankrd27	G	A	7: 35,614,521	A426T	probably benign	Het
Atg9b	C	A	5: 24,388,188	G406C	probably damaging	Het
BC005561	C	T	5: 104,520,510	A966V	probably benign	Het
C1ra	A	T	6: 124,522,766	Q637L	probably benign	Het
Cdhr2	A	T	13: 54,719,581	M438L	probably benign	Het
Cep350	T	C	1: 155,953,358	I267V	possibly damaging	Het
Chrna5	A	G	9: 55,004,642	Y138C	probably damaging	Het
Chst3	T	A	10: 60,185,703	M441L	probably benign	Het
Cmya5	G	A	13: 93,063,519	P3434S	probably benign	Het
Cog2	T	A	8: 124,525,683	L42Q	probably damaging	Het
Cpq	A	T	15: 33,250,126	I210F	probably benign	Het
Crnn	C	A	3: 93,148,458	Q184K	probably damaging	Het
Csnka2ip	A	T	16: 64,478,059	Y647*	probably null	Het
D5Ertd579e	C	T	5: 36,604,530	R1331H	probably benign	Het
Dennd5a	C	T	7: 109,917,380		probably null	Het
Dync1h1	A	G	12: 110,626,992	Q1231R	possibly damaging	Het
Erbin	T	A	13: 103,833,731	I1126F	possibly damaging	Het
Fastkd1	T	C	2: 69,702,469	D518G	probably benign	Het
Gcc1	A	G	6: 28,421,111	L69P	possibly damaging	Het
Gkn1	T	C	6: 87,347,169	Y119C	probably damaging	Het
Gmpr	T	G	13: 45,517,044	W81G	probably benign	Het
Gyg	T	A	3: 20,138,051	I236F	probably benign	Het
Hcrtr2	T	C	9: 76,246,453	Y219C	probably damaging	Het
Hmcn1	G	A	1: 150,565,369	Q5379*	probably null	Het
Kank1	T	C	19: 25,411,317	C785R	probably benign	Het
Lrp1b	A	T	2: 40,851,806	C3036*	probably null	Het
Mdga2	T	C	12: 66,689,335	D373G	probably damaging	Het
Mgat2	A	T	12: 69,185,719	I356F	probably benign	Het
Miga2	A	G	2: 30,377,997	D346G	probably damaging	Het
Mprip	T	A	11: 59,760,258	L1596Q	possibly damaging	Het
Mroh2b	G	A	15: 4,914,140	R386Q	probably benign	Het
Mst1r	T	A	9: 107,919,980	S1349R	probably benign	Het
Mtmr3	C	T	11: 4,492,825	R403H	possibly damaging	Het
Mycbpap	G	A	11: 94,508,143	Q460*	probably null	Het
Myo9a	T	C	9: 59,868,181	V1025A	probably benign	Het
Ncapd2	C	T	6: 125,168,590	E1365K	probably null	Het
Nkiras2	C	A	11: 100,625,163	D105E	probably damaging	Het
Nolc1	T	G	19: 46,081,431		probably null	Het
Nos1	T	C	5: 117,867,232	F6L	probably benign	Het
Olfr1112	G	T	2: 87,191,737	V17L	probably benign	Het
Olfr1278	T	A	2: 111,292,560	C97*	probably null	Het
Olfr1369-ps1	C	T	13: 21,116,565	T291I	probably benign	Het
Olfr218	A	T	1: 173,203,371	N5I	probably damaging	Het
Olfr325	T	C	11: 58,581,251	Y136H	probably damaging	Het
Olfr910	T	A	9: 38,539,256	Y120*	probably null	Het
Pfkm	A	G	15: 98,128,318	E598G	possibly damaging	Het
Phf2	A	T	13: 48,807,630	D861E	unknown	Het
Polr2a	A	G	11: 69,739,877		probably null	Het
Popdc2	G	A	16: 38,369,491	V167M	probably damaging	Het
Ptpn22	T	C	3: 103,885,798	S422P	probably benign	Het
Rasa2	T	C	9: 96,568,375	K490R	possibly damaging	Het
Rbfox3	T	A	11: 118,495,221	D286V	probably damaging	Het
Rdh13	A	G	7: 4,427,791	W223R	probably damaging	Het
Riok3	T	C	18: 12,128,929	S7P	probably benign	Het
Rnaseh2b	A	G	14: 62,353,632	E144G	probably benign	Het
Rnf20	C	T	4: 49,651,498	Q655*	probably null	Het
Rpap2	T	C	5: 107,603,550	Y8H	probably damaging	Het
Slc5a10	T	C	11: 61,709,602	Y181C	probably benign	Het
Spast	C	T	17: 74,356,160	Q158*	probably null	Het
Tas2r104	G	A	6: 131,685,584	S54F	probably damaging	Het
Tcaf2	C	T	6: 42,628,017	W611*	probably null	Het
Timp4	G	A	6: 115,250,403		probably null	Het
Tmem45a	G	A	16: 56,823,570	S72L	probably benign	Het
Tnrc18	T	C	5: 142,788,703	T124A	possibly damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Ttn	T	C	2: 76,942,915	D2381G	probably damaging	Het
Uevld	T	C	7: 46,955,624	T41A	possibly damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Unc5d	T	C	8: 28,696,478	E527G	probably damaging	Het
Vmn2r125	C	T	4: 156,351,038	T237I	probably benign	Het
Vmn2r63	A	C	7: 42,933,614	I59S	probably benign	Het
Vps72	G	A	3: 95,118,695	S106N	probably benign	Het
Zan	A	C	5: 137,409,669		probably benign	Het
Zbtb38	T	C	9: 96,685,462	K1190E	probably benign	Het
Zc3h6	T	C	2: 129,017,358	V1103A	probably benign	Het
Zfp407	G	A	18: 84,562,157	T277I	probably damaging	Het
Zfp804b	A	G	5: 6,769,509	S1149P	probably damaging	Het

Other mutations in Snd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00933:Snd1	APN	6	28512986	critical splice donor site	probably null
IGL00940:Snd1	APN	6	28745175	intron	probably benign
IGL01340:Snd1	APN	6	28883369	missense	probably benign
IGL01892:Snd1	APN	6	28888124	critical splice donor site	probably null
IGL02063:Snd1	APN	6	28526221	unclassified	probably benign
IGL02134:Snd1	APN	6	28880279	missense	possibly damaging	0.81
IGL02366:Snd1	APN	6	28707150	intron	probably benign
PIT4677001:Snd1	UTSW	6	28880296	missense	probably benign	0.01
R0039:Snd1	UTSW	6	28745210	missense	probably damaging	1.00
R0053:Snd1	UTSW	6	28745335	intron	probably benign
R0053:Snd1	UTSW	6	28745335	intron	probably benign
R0463:Snd1	UTSW	6	28724956	missense	probably benign	0.00
R0576:Snd1	UTSW	6	28886577	missense	probably benign	0.31
R0709:Snd1	UTSW	6	28545470	splice site	probably benign
R0959:Snd1	UTSW	6	28884971	missense	probably benign	0.01
R1853:Snd1	UTSW	6	28545564	missense	probably damaging	1.00
R2059:Snd1	UTSW	6	28745207	missense	probably damaging	1.00
R2497:Snd1	UTSW	6	28888079	missense	probably benign
R3832:Snd1	UTSW	6	28531404	splice site	probably benign
R3833:Snd1	UTSW	6	28531404	splice site	probably benign
R4643:Snd1	UTSW	6	28880249	missense	probably benign	0.00
R4665:Snd1	UTSW	6	28707054	missense	probably damaging	1.00
R4843:Snd1	UTSW	6	28668643	missense	probably damaging	1.00
R4884:Snd1	UTSW	6	28526912	missense	possibly damaging	0.94
R4959:Snd1	UTSW	6	28884251	nonsense	probably null
R4973:Snd1	UTSW	6	28884251	nonsense	probably null
R5065:Snd1	UTSW	6	28888240	missense	probably damaging	1.00
R5066:Snd1	UTSW	6	28888240	missense	probably damaging	1.00
R5067:Snd1	UTSW	6	28888240	missense	probably damaging	1.00
R5131:Snd1	UTSW	6	28885050	missense	probably damaging	0.99
R5172:Snd1	UTSW	6	28886616	missense	possibly damaging	0.91
R5239:Snd1	UTSW	6	28545525	missense	probably damaging	1.00
R5313:Snd1	UTSW	6	28668601	missense	probably benign	0.15
R5395:Snd1	UTSW	6	28526184	missense	probably damaging	0.99
R5938:Snd1	UTSW	6	28874859	critical splice acceptor site	probably null
R6019:Snd1	UTSW	6	28880234	missense	probably benign	0.00
R6248:Snd1	UTSW	6	28520235	nonsense	probably null
R6337:Snd1	UTSW	6	28888289	missense	probably damaging	1.00
R6810:Snd1	UTSW	6	28668610	missense	probably benign	0.23
R6932:Snd1	UTSW	6	28626101	missense	probably benign	0.42
R7469:Snd1	UTSW	6	28626127	missense	probably damaging	1.00
R7485:Snd1	UTSW	6	28531450	missense	probably benign	0.14
R7571:Snd1	UTSW	6	28526203	missense	possibly damaging	0.81
R7866:Snd1	UTSW	6	28527725	missense	probably damaging	1.00
R8178:Snd1	UTSW	6	28874976	missense	possibly damaging	0.85
R8208:Snd1	UTSW	6	28526055	missense	possibly damaging	0.86
R8526:Snd1	UTSW	6	28745254	missense	probably benign	0.00
R8848:Snd1	UTSW	6	28874963	missense	possibly damaging	0.72
R8854:Snd1	UTSW	6	28526969	missense	probably benign	0.02
R9310:Snd1	UTSW	6	28795937	missense	probably null	1.00
R9326:Snd1	UTSW	6	28795843	nonsense	probably null
R9348:Snd1	UTSW	6	28745207	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCTCATTCAAGAGCACCTCCATC -3'
(R):5'- CTGTACACTGAAGCAAGCTAGACCC -3'

Sequencing Primer
(F):5'- TTATGTCCCTCAGATCACAGAATAC -3'
(R):5'- TGAAGCAAGCTAGACCCAATCTATAC -3'

Posted On

2014-05-14