Incidental Mutation 'R1698:C1ra'
ID192406
Institutional Source Beutler Lab
Gene Symbol C1ra
Ensembl Gene ENSMUSG00000055172
Gene Namecomplement component 1, r subcomponent A
SynonymsmC1rA
MMRRC Submission 039731-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1698 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124512405-124523443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124522766 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 637 (Q637L)
Ref Sequence ENSEMBL: ENSMUSP00000063707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068593]
Predicted Effect probably benign
Transcript: ENSMUST00000068593
AA Change: Q637L

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000063707
Gene: ENSMUSG00000055172
AA Change: Q637L

DomainStartEndE-ValueType
CUB 14 140 1.56e-35 SMART
EGF_CA 141 189 1.88e-10 SMART
CUB 192 304 4.74e-35 SMART
CCP 308 370 5.56e-9 SMART
CCP 375 446 1.53e-6 SMART
Tryp_SPc 462 699 2.7e-71 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,645,158 E340A possibly damaging Het
Abca13 A G 11: 9,314,507 D2963G probably benign Het
Actn3 T C 19: 4,862,207 D783G possibly damaging Het
Adamtsl2 A G 2: 27,103,127 E723G possibly damaging Het
Agrn G T 4: 156,166,558 Q1931K probably benign Het
Ankrd27 G A 7: 35,614,521 A426T probably benign Het
Atg9b C A 5: 24,388,188 G406C probably damaging Het
BC005561 C T 5: 104,520,510 A966V probably benign Het
Cdhr2 A T 13: 54,719,581 M438L probably benign Het
Cep350 T C 1: 155,953,358 I267V possibly damaging Het
Chrna5 A G 9: 55,004,642 Y138C probably damaging Het
Chst3 T A 10: 60,185,703 M441L probably benign Het
Cmya5 G A 13: 93,063,519 P3434S probably benign Het
Cog2 T A 8: 124,525,683 L42Q probably damaging Het
Cpq A T 15: 33,250,126 I210F probably benign Het
Crnn C A 3: 93,148,458 Q184K probably damaging Het
Csnka2ip A T 16: 64,478,059 Y647* probably null Het
D5Ertd579e C T 5: 36,604,530 R1331H probably benign Het
Dennd5a C T 7: 109,917,380 probably null Het
Dync1h1 A G 12: 110,626,992 Q1231R possibly damaging Het
Erbin T A 13: 103,833,731 I1126F possibly damaging Het
Fastkd1 T C 2: 69,702,469 D518G probably benign Het
Gcc1 A G 6: 28,421,111 L69P possibly damaging Het
Gkn1 T C 6: 87,347,169 Y119C probably damaging Het
Gmpr T G 13: 45,517,044 W81G probably benign Het
Gyg T A 3: 20,138,051 I236F probably benign Het
Hcrtr2 T C 9: 76,246,453 Y219C probably damaging Het
Hmcn1 G A 1: 150,565,369 Q5379* probably null Het
Kank1 T C 19: 25,411,317 C785R probably benign Het
Lrp1b A T 2: 40,851,806 C3036* probably null Het
Mdga2 T C 12: 66,689,335 D373G probably damaging Het
Mgat2 A T 12: 69,185,719 I356F probably benign Het
Miga2 A G 2: 30,377,997 D346G probably damaging Het
Mprip T A 11: 59,760,258 L1596Q possibly damaging Het
Mroh2b G A 15: 4,914,140 R386Q probably benign Het
Mst1r T A 9: 107,919,980 S1349R probably benign Het
Mtmr3 C T 11: 4,492,825 R403H possibly damaging Het
Mycbpap G A 11: 94,508,143 Q460* probably null Het
Myo9a T C 9: 59,868,181 V1025A probably benign Het
Ncapd2 C T 6: 125,168,590 E1365K probably null Het
Nkiras2 C A 11: 100,625,163 D105E probably damaging Het
Nolc1 T G 19: 46,081,431 probably null Het
Nos1 T C 5: 117,867,232 F6L probably benign Het
Olfr1112 G T 2: 87,191,737 V17L probably benign Het
Olfr1278 T A 2: 111,292,560 C97* probably null Het
Olfr1369-ps1 C T 13: 21,116,565 T291I probably benign Het
Olfr218 A T 1: 173,203,371 N5I probably damaging Het
Olfr325 T C 11: 58,581,251 Y136H probably damaging Het
Olfr910 T A 9: 38,539,256 Y120* probably null Het
Pfkm A G 15: 98,128,318 E598G possibly damaging Het
Phf2 A T 13: 48,807,630 D861E unknown Het
Polr2a A G 11: 69,739,877 probably null Het
Popdc2 G A 16: 38,369,491 V167M probably damaging Het
Ptpn22 T C 3: 103,885,798 S422P probably benign Het
Rasa2 T C 9: 96,568,375 K490R possibly damaging Het
Rbfox3 T A 11: 118,495,221 D286V probably damaging Het
Rdh13 A G 7: 4,427,791 W223R probably damaging Het
Riok3 T C 18: 12,128,929 S7P probably benign Het
Rnaseh2b A G 14: 62,353,632 E144G probably benign Het
Rnf20 C T 4: 49,651,498 Q655* probably null Het
Rpap2 T C 5: 107,603,550 Y8H probably damaging Het
Slc5a10 T C 11: 61,709,602 Y181C probably benign Het
Snd1 G T 6: 28,888,253 G896* probably null Het
Spast C T 17: 74,356,160 Q158* probably null Het
Tas2r104 G A 6: 131,685,584 S54F probably damaging Het
Tcaf2 C T 6: 42,628,017 W611* probably null Het
Timp4 G A 6: 115,250,403 probably null Het
Tmem45a G A 16: 56,823,570 S72L probably benign Het
Tnrc18 T C 5: 142,788,703 T124A possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttn T C 2: 76,942,915 D2381G probably damaging Het
Uevld T C 7: 46,955,624 T41A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc5d T C 8: 28,696,478 E527G probably damaging Het
Vmn2r125 C T 4: 156,351,038 T237I probably benign Het
Vmn2r63 A C 7: 42,933,614 I59S probably benign Het
Vps72 G A 3: 95,118,695 S106N probably benign Het
Zan A C 5: 137,409,669 probably benign Het
Zbtb38 T C 9: 96,685,462 K1190E probably benign Het
Zc3h6 T C 2: 129,017,358 V1103A probably benign Het
Zfp407 G A 18: 84,562,157 T277I probably damaging Het
Zfp804b A G 5: 6,769,509 S1149P probably damaging Het
Other mutations in C1ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:C1ra APN 6 124522291 missense probably benign 0.00
IGL03079:C1ra APN 6 124519835 missense probably damaging 1.00
IGL03151:C1ra APN 6 124519771 missense probably benign 0.09
mueller-eberhardt UTSW 6 124512801 critical splice donor site probably null
pillemer UTSW 6 124516724 missense probably damaging 1.00
R0331:C1ra UTSW 6 124519435 splice site probably null
R0457:C1ra UTSW 6 124522753 missense probably benign
R0472:C1ra UTSW 6 124517444 missense possibly damaging 0.95
R0570:C1ra UTSW 6 124513705 missense probably benign 0.00
R0634:C1ra UTSW 6 124517505 missense possibly damaging 0.49
R0661:C1ra UTSW 6 124522377 missense probably benign
R1451:C1ra UTSW 6 124521641 missense probably benign 0.04
R1640:C1ra UTSW 6 124522274 missense probably benign 0.17
R4020:C1ra UTSW 6 124519777 missense probably benign 0.01
R4801:C1ra UTSW 6 124513768 missense probably benign 0.00
R4802:C1ra UTSW 6 124513768 missense probably benign 0.00
R4909:C1ra UTSW 6 124522334 missense probably damaging 1.00
R5086:C1ra UTSW 6 124519729 missense probably damaging 1.00
R5108:C1ra UTSW 6 124522922 missense probably damaging 1.00
R5372:C1ra UTSW 6 124521625 missense probably damaging 1.00
R5421:C1ra UTSW 6 124522790 missense probably benign 0.36
R5635:C1ra UTSW 6 124516724 missense probably damaging 1.00
R6438:C1ra UTSW 6 124513777 missense possibly damaging 0.54
R6518:C1ra UTSW 6 124521575 intron probably null
R6738:C1ra UTSW 6 124517759 missense probably damaging 1.00
R6804:C1ra UTSW 6 124517725 missense probably benign
R6805:C1ra UTSW 6 124517725 missense probably benign
R6939:C1ra UTSW 6 124512801 critical splice donor site probably null
R6981:C1ra UTSW 6 124517725 missense probably benign
R6982:C1ra UTSW 6 124517725 missense probably benign
R7056:C1ra UTSW 6 124517725 missense probably benign
R7057:C1ra UTSW 6 124517725 missense probably benign
R7094:C1ra UTSW 6 124517725 missense probably benign
R7468:C1ra UTSW 6 124522444 nonsense probably null
R7476:C1ra UTSW 6 124522699 missense probably damaging 1.00
R7478:C1ra UTSW 6 124517725 missense probably benign
R7479:C1ra UTSW 6 124517725 missense probably benign
R7481:C1ra UTSW 6 124517725 missense probably benign
R7512:C1ra UTSW 6 124517725 missense probably benign
X0062:C1ra UTSW 6 124522439 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGGGCCACACAAATGTGGAAC -3'
(R):5'- ACCCTGGATTCTGACCCAGTGAAC -3'

Sequencing Primer
(F):5'- TTGCTCTACTGGAGCTGGAAAAC -3'
(R):5'- CCAGTCAACATAATTCAGTACCTTG -3'
Posted On2014-05-14