Incidental Mutation 'R1698:Dennd5a'
ID 192414
Institutional Source Beutler Lab
Gene Symbol Dennd5a
Ensembl Gene ENSMUSG00000035901
Gene Name DENN domain containing 5A
Synonyms Rab6ip1, 1500012B19Rik, ORF37
MMRRC Submission 039731-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.199) question?
Stock # R1698 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 109492987-109559677 bp(-) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) C to T at 109516587 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080437] [ENSMUST00000106722]
AlphaFold Q6PAL8
Predicted Effect probably null
Transcript: ENSMUST00000080437
SMART Domains Protein: ENSMUSP00000079295
Gene: ENSMUSG00000035901

DomainStartEndE-ValueType
uDENN 12 138 7.71e-45 SMART
DENN 202 390 9.28e-80 SMART
dDENN 512 588 4.06e-21 SMART
low complexity region 832 844 N/A INTRINSIC
RUN 884 947 4.9e-22 SMART
Pfam:PLAT 956 1062 1e-15 PFAM
RUN 1218 1278 3.69e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106722
SMART Domains Protein: ENSMUSP00000102333
Gene: ENSMUSG00000035901

DomainStartEndE-ValueType
uDENN 12 114 2.32e-39 SMART
DENN 178 366 9.28e-80 SMART
dDENN 488 564 4.06e-21 SMART
low complexity region 808 820 N/A INTRINSIC
RUN 860 923 4.9e-22 SMART
Pfam:PLAT 932 1038 2.8e-18 PFAM
RUN 1194 1254 3.69e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154002
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN-domain-containing protein that functions as a RAB-activating guanine nucleotide exchange factor (GEF). This protein catalyzes the conversion of GDP to GTP and thereby converts inactive GDP-bound Rab proteins into their active GTP-bound form. The encoded protein is recruited by RAB6 onto Golgi membranes and is therefore referred to as RAB6-interacting protein 1. This protein binds with RAB39 as well. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene are associated with early infantile epileptic encephalopathy-49. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,622,117 (GRCm39) E340A possibly damaging Het
Abca13 A G 11: 9,264,507 (GRCm39) D2963G probably benign Het
Actn3 T C 19: 4,912,235 (GRCm39) D783G possibly damaging Het
Adamtsl2 A G 2: 26,993,139 (GRCm39) E723G possibly damaging Het
Agrn G T 4: 156,251,015 (GRCm39) Q1931K probably benign Het
Ankrd27 G A 7: 35,313,946 (GRCm39) A426T probably benign Het
Atg9b C A 5: 24,593,186 (GRCm39) G406C probably damaging Het
C1ra A T 6: 124,499,725 (GRCm39) Q637L probably benign Het
Cdhr2 A T 13: 54,867,394 (GRCm39) M438L probably benign Het
Cep350 T C 1: 155,829,104 (GRCm39) I267V possibly damaging Het
Chrna5 A G 9: 54,911,926 (GRCm39) Y138C probably damaging Het
Chst3 T A 10: 60,021,525 (GRCm39) M441L probably benign Het
Cmya5 G A 13: 93,200,027 (GRCm39) P3434S probably benign Het
Cog2 T A 8: 125,252,422 (GRCm39) L42Q probably damaging Het
Cpq A T 15: 33,250,272 (GRCm39) I210F probably benign Het
Crnn C A 3: 93,055,765 (GRCm39) Q184K probably damaging Het
Csnka2ip A T 16: 64,298,422 (GRCm39) Y647* probably null Het
D5Ertd579e C T 5: 36,761,874 (GRCm39) R1331H probably benign Het
Dync1h1 A G 12: 110,593,426 (GRCm39) Q1231R possibly damaging Het
Erbin T A 13: 103,970,239 (GRCm39) I1126F possibly damaging Het
Fastkd1 T C 2: 69,532,813 (GRCm39) D518G probably benign Het
Gcc1 A G 6: 28,421,110 (GRCm39) L69P possibly damaging Het
Gkn1 T C 6: 87,324,151 (GRCm39) Y119C probably damaging Het
Gmpr T G 13: 45,670,520 (GRCm39) W81G probably benign Het
Gyg1 T A 3: 20,192,215 (GRCm39) I236F probably benign Het
Hcrtr2 T C 9: 76,153,735 (GRCm39) Y219C probably damaging Het
Hmcn1 G A 1: 150,441,120 (GRCm39) Q5379* probably null Het
Kank1 T C 19: 25,388,681 (GRCm39) C785R probably benign Het
Lrp1b A T 2: 40,741,818 (GRCm39) C3036* probably null Het
Mdga2 T C 12: 66,736,109 (GRCm39) D373G probably damaging Het
Mgat2 A T 12: 69,232,493 (GRCm39) I356F probably benign Het
Miga2 A G 2: 30,268,009 (GRCm39) D346G probably damaging Het
Mprip T A 11: 59,651,084 (GRCm39) L1596Q possibly damaging Het
Mroh2b G A 15: 4,943,622 (GRCm39) R386Q probably benign Het
Mst1r T A 9: 107,797,179 (GRCm39) S1349R probably benign Het
Mtmr3 C T 11: 4,442,825 (GRCm39) R403H possibly damaging Het
Mycbpap G A 11: 94,398,969 (GRCm39) Q460* probably null Het
Myo9a T C 9: 59,775,464 (GRCm39) V1025A probably benign Het
Ncapd2 C T 6: 125,145,553 (GRCm39) E1365K probably null Het
Nkiras2 C A 11: 100,515,989 (GRCm39) D105E probably damaging Het
Nolc1 T G 19: 46,069,870 (GRCm39) probably null Het
Nos1 T C 5: 118,005,297 (GRCm39) F6L probably benign Het
Or10j3 A T 1: 173,030,938 (GRCm39) N5I probably damaging Het
Or12e1 G T 2: 87,022,081 (GRCm39) V17L probably benign Het
Or2t46 T C 11: 58,472,077 (GRCm39) Y136H probably damaging Het
Or2w1b C T 13: 21,300,735 (GRCm39) T291I probably benign Het
Or4f54 T A 2: 111,122,905 (GRCm39) C97* probably null Het
Or8b46 T A 9: 38,450,552 (GRCm39) Y120* probably null Het
Pfkm A G 15: 98,026,199 (GRCm39) E598G possibly damaging Het
Phf2 A T 13: 48,961,106 (GRCm39) D861E unknown Het
Polr2a A G 11: 69,630,703 (GRCm39) probably null Het
Popdc2 G A 16: 38,189,853 (GRCm39) V167M probably damaging Het
Ptpn22 T C 3: 103,793,114 (GRCm39) S422P probably benign Het
Rasa2 T C 9: 96,450,428 (GRCm39) K490R possibly damaging Het
Rbfox3 T A 11: 118,386,047 (GRCm39) D286V probably damaging Het
Rdh13 A G 7: 4,430,790 (GRCm39) W223R probably damaging Het
Riok3 T C 18: 12,261,986 (GRCm39) S7P probably benign Het
Rnaseh2b A G 14: 62,591,081 (GRCm39) E144G probably benign Het
Rnf20 C T 4: 49,651,498 (GRCm39) Q655* probably null Het
Rpap2 T C 5: 107,751,416 (GRCm39) Y8H probably damaging Het
Slc5a10 T C 11: 61,600,428 (GRCm39) Y181C probably benign Het
Snd1 G T 6: 28,888,252 (GRCm39) G896* probably null Het
Spast C T 17: 74,663,155 (GRCm39) Q158* probably null Het
Tas2r104 G A 6: 131,662,547 (GRCm39) S54F probably damaging Het
Tcaf2 C T 6: 42,604,951 (GRCm39) W611* probably null Het
Thoc2l C T 5: 104,668,376 (GRCm39) A966V probably benign Het
Timp4 G A 6: 115,227,364 (GRCm39) probably null Het
Tmem45a G A 16: 56,643,933 (GRCm39) S72L probably benign Het
Tnrc18 T C 5: 142,774,458 (GRCm39) T124A possibly damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Ttn T C 2: 76,773,259 (GRCm39) D2381G probably damaging Het
Uevld T C 7: 46,605,372 (GRCm39) T41A possibly damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Unc5d T C 8: 29,186,506 (GRCm39) E527G probably damaging Het
Vmn2r125 C T 4: 156,703,333 (GRCm39) T237I probably benign Het
Vmn2r63 A C 7: 42,583,038 (GRCm39) I59S probably benign Het
Vps72 G A 3: 95,026,006 (GRCm39) S106N probably benign Het
Zan A C 5: 137,407,931 (GRCm39) probably benign Het
Zbtb38 T C 9: 96,567,515 (GRCm39) K1190E probably benign Het
Zc3h6 T C 2: 128,859,278 (GRCm39) V1103A probably benign Het
Zfp407 G A 18: 84,580,282 (GRCm39) T277I probably damaging Het
Zfp804b A G 5: 6,819,509 (GRCm39) S1149P probably damaging Het
Other mutations in Dennd5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Dennd5a APN 7 109,507,579 (GRCm39) missense probably benign
IGL01338:Dennd5a APN 7 109,518,611 (GRCm39) missense possibly damaging 0.92
IGL01618:Dennd5a APN 7 109,533,302 (GRCm39) missense probably damaging 1.00
IGL02047:Dennd5a APN 7 109,533,991 (GRCm39) missense possibly damaging 0.92
IGL02277:Dennd5a APN 7 109,497,176 (GRCm39) missense possibly damaging 0.61
IGL02492:Dennd5a APN 7 109,532,844 (GRCm39) missense probably benign
IGL02697:Dennd5a APN 7 109,493,988 (GRCm39) missense probably damaging 1.00
IGL02935:Dennd5a APN 7 109,520,514 (GRCm39) missense possibly damaging 0.80
IGL02986:Dennd5a APN 7 109,534,731 (GRCm39) missense probably benign
IGL03088:Dennd5a APN 7 109,507,588 (GRCm39) missense probably damaging 1.00
IGL03156:Dennd5a APN 7 109,518,462 (GRCm39) splice site probably benign
IGL03181:Dennd5a APN 7 109,532,865 (GRCm39) missense probably damaging 1.00
big_pal UTSW 7 109,518,630 (GRCm39) nonsense probably null
Celestial UTSW 7 109,500,296 (GRCm39) missense probably damaging 1.00
PIT4434001:Dennd5a UTSW 7 109,532,831 (GRCm39) missense probably damaging 1.00
R0055:Dennd5a UTSW 7 109,498,998 (GRCm39) missense possibly damaging 0.72
R0055:Dennd5a UTSW 7 109,498,998 (GRCm39) missense possibly damaging 0.72
R0092:Dennd5a UTSW 7 109,499,013 (GRCm39) missense possibly damaging 0.95
R0111:Dennd5a UTSW 7 109,533,961 (GRCm39) missense probably damaging 1.00
R0517:Dennd5a UTSW 7 109,533,968 (GRCm39) missense probably damaging 1.00
R0546:Dennd5a UTSW 7 109,520,633 (GRCm39) missense probably benign 0.01
R0811:Dennd5a UTSW 7 109,532,820 (GRCm39) missense possibly damaging 0.93
R0812:Dennd5a UTSW 7 109,532,820 (GRCm39) missense possibly damaging 0.93
R0827:Dennd5a UTSW 7 109,498,938 (GRCm39) missense probably damaging 1.00
R0831:Dennd5a UTSW 7 109,533,961 (GRCm39) missense probably damaging 1.00
R1075:Dennd5a UTSW 7 109,517,808 (GRCm39) missense probably benign
R1115:Dennd5a UTSW 7 109,517,968 (GRCm39) missense probably damaging 1.00
R1128:Dennd5a UTSW 7 109,520,541 (GRCm39) nonsense probably null
R1300:Dennd5a UTSW 7 109,518,614 (GRCm39) missense probably benign
R1711:Dennd5a UTSW 7 109,517,919 (GRCm39) missense probably benign 0.00
R1771:Dennd5a UTSW 7 109,517,893 (GRCm39) missense probably damaging 0.98
R1803:Dennd5a UTSW 7 109,497,820 (GRCm39) missense probably benign 0.00
R2064:Dennd5a UTSW 7 109,497,900 (GRCm39) splice site probably benign
R2176:Dennd5a UTSW 7 109,504,327 (GRCm39) splice site probably null
R2182:Dennd5a UTSW 7 109,533,201 (GRCm39) missense probably benign 0.03
R2852:Dennd5a UTSW 7 109,532,878 (GRCm39) missense probably damaging 1.00
R2853:Dennd5a UTSW 7 109,532,878 (GRCm39) missense probably damaging 1.00
R3035:Dennd5a UTSW 7 109,520,559 (GRCm39) missense probably benign 0.00
R3835:Dennd5a UTSW 7 109,533,449 (GRCm39) missense probably benign 0.00
R3953:Dennd5a UTSW 7 109,504,906 (GRCm39) missense probably benign 0.44
R3954:Dennd5a UTSW 7 109,504,906 (GRCm39) missense probably benign 0.44
R3955:Dennd5a UTSW 7 109,504,906 (GRCm39) missense probably benign 0.44
R3957:Dennd5a UTSW 7 109,504,906 (GRCm39) missense probably benign 0.44
R4014:Dennd5a UTSW 7 109,534,688 (GRCm39) critical splice donor site probably null
R4166:Dennd5a UTSW 7 109,526,032 (GRCm39) critical splice donor site probably null
R4362:Dennd5a UTSW 7 109,495,550 (GRCm39) missense probably damaging 1.00
R4567:Dennd5a UTSW 7 109,498,942 (GRCm39) missense probably benign 0.06
R4700:Dennd5a UTSW 7 109,520,405 (GRCm39) missense probably benign 0.01
R4734:Dennd5a UTSW 7 109,495,543 (GRCm39) missense probably damaging 0.96
R4914:Dennd5a UTSW 7 109,500,296 (GRCm39) missense probably damaging 1.00
R4915:Dennd5a UTSW 7 109,500,296 (GRCm39) missense probably damaging 1.00
R4918:Dennd5a UTSW 7 109,500,296 (GRCm39) missense probably damaging 1.00
R4992:Dennd5a UTSW 7 109,493,919 (GRCm39) missense probably damaging 0.98
R5011:Dennd5a UTSW 7 109,513,983 (GRCm39) missense possibly damaging 0.89
R5013:Dennd5a UTSW 7 109,513,983 (GRCm39) missense possibly damaging 0.89
R5034:Dennd5a UTSW 7 109,499,004 (GRCm39) missense probably damaging 0.98
R5194:Dennd5a UTSW 7 109,532,936 (GRCm39) missense probably damaging 1.00
R5359:Dennd5a UTSW 7 109,497,169 (GRCm39) missense probably damaging 1.00
R5430:Dennd5a UTSW 7 109,533,447 (GRCm39) missense probably damaging 1.00
R5586:Dennd5a UTSW 7 109,504,928 (GRCm39) missense possibly damaging 0.72
R5607:Dennd5a UTSW 7 109,518,630 (GRCm39) nonsense probably null
R5608:Dennd5a UTSW 7 109,518,630 (GRCm39) nonsense probably null
R5783:Dennd5a UTSW 7 109,493,843 (GRCm39) missense probably damaging 0.97
R5866:Dennd5a UTSW 7 109,518,567 (GRCm39) missense probably benign 0.00
R5890:Dennd5a UTSW 7 109,533,428 (GRCm39) missense probably benign 0.00
R6053:Dennd5a UTSW 7 109,532,952 (GRCm39) missense probably damaging 1.00
R6247:Dennd5a UTSW 7 109,497,889 (GRCm39) missense probably damaging 1.00
R6362:Dennd5a UTSW 7 109,533,472 (GRCm39) nonsense probably null
R6446:Dennd5a UTSW 7 109,493,873 (GRCm39) missense probably damaging 1.00
R6894:Dennd5a UTSW 7 109,500,325 (GRCm39) missense probably damaging 1.00
R7061:Dennd5a UTSW 7 109,504,386 (GRCm39) missense probably benign 0.19
R7115:Dennd5a UTSW 7 109,493,961 (GRCm39) missense probably damaging 1.00
R7133:Dennd5a UTSW 7 109,495,449 (GRCm39) critical splice donor site probably null
R7302:Dennd5a UTSW 7 109,504,906 (GRCm39) missense probably damaging 0.98
R7339:Dennd5a UTSW 7 109,500,366 (GRCm39) missense probably damaging 1.00
R7704:Dennd5a UTSW 7 109,496,174 (GRCm39) missense possibly damaging 0.85
R7756:Dennd5a UTSW 7 109,520,714 (GRCm39) missense possibly damaging 0.95
R7838:Dennd5a UTSW 7 109,533,196 (GRCm39) missense probably benign
R7873:Dennd5a UTSW 7 109,526,141 (GRCm39) missense probably damaging 1.00
R8124:Dennd5a UTSW 7 109,497,142 (GRCm39) missense probably damaging 1.00
R8309:Dennd5a UTSW 7 109,500,332 (GRCm39) missense probably damaging 1.00
R8345:Dennd5a UTSW 7 109,504,477 (GRCm39) missense possibly damaging 0.55
R8560:Dennd5a UTSW 7 109,533,898 (GRCm39) critical splice donor site probably null
R9104:Dennd5a UTSW 7 109,497,713 (GRCm39) critical splice donor site probably null
R9218:Dennd5a UTSW 7 109,507,592 (GRCm39) missense probably damaging 1.00
R9348:Dennd5a UTSW 7 109,498,942 (GRCm39) missense probably benign 0.00
R9348:Dennd5a UTSW 7 109,498,930 (GRCm39) critical splice donor site probably null
R9566:Dennd5a UTSW 7 109,533,254 (GRCm39) missense probably benign 0.01
R9608:Dennd5a UTSW 7 109,520,713 (GRCm39) missense probably damaging 1.00
R9756:Dennd5a UTSW 7 109,496,174 (GRCm39) missense possibly damaging 0.85
R9800:Dennd5a UTSW 7 109,500,374 (GRCm39) missense probably benign 0.40
Z1088:Dennd5a UTSW 7 109,504,480 (GRCm39) missense probably damaging 1.00
Z1088:Dennd5a UTSW 7 109,493,954 (GRCm39) missense possibly damaging 0.73
Z1177:Dennd5a UTSW 7 109,533,231 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTCATTTTAACCCATCGGCTGC -3'
(R):5'- TGCCCAATGGACAGGATGTTTTCC -3'

Sequencing Primer
(F):5'- agcaccagcctttcatcc -3'
(R):5'- TGGCTTTTTCCCTAAGCTGC -3'
Posted On 2014-05-14