Mutagenetix > Incidental Mutation

Incidental Mutation 'R1698:Myo9a'

192419

Institutional Source

Beutler Lab

Gene Symbol

Myo9a

Ensembl Gene

ENSMUSG00000039585

Gene Name

myosin IXa

Synonyms

C130068I12Rik, 4732465J09Rik

MMRRC Submission

039731-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1698 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59750896-59928866 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 59868181 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1025 (V1025A)

Ref Sequence

ENSEMBL: ENSMUSP00000122852 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000128341] [ENSMUST00000135298] [ENSMUST00000136740]

AlphaFold

Q8C170

Predicted Effect

probably benign
Transcript: ENSMUST00000128341
AA Change: V1025A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000119401
Gene: ENSMUSG00000039585
AA Change: V1025A

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
Blast:MYSc	1685	1938	6e-89	BLAST
low complexity region	1982	1993	N/A	INTRINSIC
C1	2002	2050	2.6e-9	SMART
RhoGAP	2075	2250	3.36e-73	SMART
coiled coil region	2320	2360	N/A	INTRINSIC
low complexity region	2419	2438	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135298
AA Change: V1025A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000117432
Gene: ENSMUSG00000039585
AA Change: V1025A

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
low complexity region	1744	1759	N/A	INTRINSIC
low complexity region	2053	2064	N/A	INTRINSIC
C1	2073	2121	2.6e-9	SMART
RhoGAP	2146	2321	3.36e-73	SMART
coiled coil region	2391	2431	N/A	INTRINSIC
low complexity region	2490	2509	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136740
AA Change: V1025A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000122852
Gene: ENSMUSG00000039585
AA Change: V1025A

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
low complexity region	1744	1759	N/A	INTRINSIC
low complexity region	2053	2064	N/A	INTRINSIC
C1	2073	2121	2.6e-9	SMART
RhoGAP	2146	2321	3.36e-73	SMART
coiled coil region	2409	2449	N/A	INTRINSIC
low complexity region	2508	2527	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147364

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215963

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with Bardet-Biedl Syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous KO leads to obstructive hydrocephaly caused by blockage of the third ventricle and the rostral aqueduct caused by developmental failures of their ependymal cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	C	6: 121,645,158	E340A	possibly damaging	Het
Abca13	A	G	11: 9,314,507	D2963G	probably benign	Het
Actn3	T	C	19: 4,862,207	D783G	possibly damaging	Het
Adamtsl2	A	G	2: 27,103,127	E723G	possibly damaging	Het
Agrn	G	T	4: 156,166,558	Q1931K	probably benign	Het
Ankrd27	G	A	7: 35,614,521	A426T	probably benign	Het
Atg9b	C	A	5: 24,388,188	G406C	probably damaging	Het
BC005561	C	T	5: 104,520,510	A966V	probably benign	Het
C1ra	A	T	6: 124,522,766	Q637L	probably benign	Het
Cdhr2	A	T	13: 54,719,581	M438L	probably benign	Het
Cep350	T	C	1: 155,953,358	I267V	possibly damaging	Het
Chrna5	A	G	9: 55,004,642	Y138C	probably damaging	Het
Chst3	T	A	10: 60,185,703	M441L	probably benign	Het
Cmya5	G	A	13: 93,063,519	P3434S	probably benign	Het
Cog2	T	A	8: 124,525,683	L42Q	probably damaging	Het
Cpq	A	T	15: 33,250,126	I210F	probably benign	Het
Crnn	C	A	3: 93,148,458	Q184K	probably damaging	Het
Csnka2ip	A	T	16: 64,478,059	Y647*	probably null	Het
D5Ertd579e	C	T	5: 36,604,530	R1331H	probably benign	Het
Dennd5a	C	T	7: 109,917,380		probably null	Het
Dync1h1	A	G	12: 110,626,992	Q1231R	possibly damaging	Het
Erbin	T	A	13: 103,833,731	I1126F	possibly damaging	Het
Fastkd1	T	C	2: 69,702,469	D518G	probably benign	Het
Gcc1	A	G	6: 28,421,111	L69P	possibly damaging	Het
Gkn1	T	C	6: 87,347,169	Y119C	probably damaging	Het
Gmpr	T	G	13: 45,517,044	W81G	probably benign	Het
Gyg	T	A	3: 20,138,051	I236F	probably benign	Het
Hcrtr2	T	C	9: 76,246,453	Y219C	probably damaging	Het
Hmcn1	G	A	1: 150,565,369	Q5379*	probably null	Het
Kank1	T	C	19: 25,411,317	C785R	probably benign	Het
Lrp1b	A	T	2: 40,851,806	C3036*	probably null	Het
Mdga2	T	C	12: 66,689,335	D373G	probably damaging	Het
Mgat2	A	T	12: 69,185,719	I356F	probably benign	Het
Miga2	A	G	2: 30,377,997	D346G	probably damaging	Het
Mprip	T	A	11: 59,760,258	L1596Q	possibly damaging	Het
Mroh2b	G	A	15: 4,914,140	R386Q	probably benign	Het
Mst1r	T	A	9: 107,919,980	S1349R	probably benign	Het
Mtmr3	C	T	11: 4,492,825	R403H	possibly damaging	Het
Mycbpap	G	A	11: 94,508,143	Q460*	probably null	Het
Ncapd2	C	T	6: 125,168,590	E1365K	probably null	Het
Nkiras2	C	A	11: 100,625,163	D105E	probably damaging	Het
Nolc1	T	G	19: 46,081,431		probably null	Het
Nos1	T	C	5: 117,867,232	F6L	probably benign	Het
Olfr1112	G	T	2: 87,191,737	V17L	probably benign	Het
Olfr1278	T	A	2: 111,292,560	C97*	probably null	Het
Olfr1369-ps1	C	T	13: 21,116,565	T291I	probably benign	Het
Olfr218	A	T	1: 173,203,371	N5I	probably damaging	Het
Olfr325	T	C	11: 58,581,251	Y136H	probably damaging	Het
Olfr910	T	A	9: 38,539,256	Y120*	probably null	Het
Pfkm	A	G	15: 98,128,318	E598G	possibly damaging	Het
Phf2	A	T	13: 48,807,630	D861E	unknown	Het
Polr2a	A	G	11: 69,739,877		probably null	Het
Popdc2	G	A	16: 38,369,491	V167M	probably damaging	Het
Ptpn22	T	C	3: 103,885,798	S422P	probably benign	Het
Rasa2	T	C	9: 96,568,375	K490R	possibly damaging	Het
Rbfox3	T	A	11: 118,495,221	D286V	probably damaging	Het
Rdh13	A	G	7: 4,427,791	W223R	probably damaging	Het
Riok3	T	C	18: 12,128,929	S7P	probably benign	Het
Rnaseh2b	A	G	14: 62,353,632	E144G	probably benign	Het
Rnf20	C	T	4: 49,651,498	Q655*	probably null	Het
Rpap2	T	C	5: 107,603,550	Y8H	probably damaging	Het
Slc5a10	T	C	11: 61,709,602	Y181C	probably benign	Het
Snd1	G	T	6: 28,888,253	G896*	probably null	Het
Spast	C	T	17: 74,356,160	Q158*	probably null	Het
Tas2r104	G	A	6: 131,685,584	S54F	probably damaging	Het
Tcaf2	C	T	6: 42,628,017	W611*	probably null	Het
Timp4	G	A	6: 115,250,403		probably null	Het
Tmem45a	G	A	16: 56,823,570	S72L	probably benign	Het
Tnrc18	T	C	5: 142,788,703	T124A	possibly damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Ttn	T	C	2: 76,942,915	D2381G	probably damaging	Het
Uevld	T	C	7: 46,955,624	T41A	possibly damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Unc5d	T	C	8: 28,696,478	E527G	probably damaging	Het
Vmn2r125	C	T	4: 156,351,038	T237I	probably benign	Het
Vmn2r63	A	C	7: 42,933,614	I59S	probably benign	Het
Vps72	G	A	3: 95,118,695	S106N	probably benign	Het
Zan	A	C	5: 137,409,669		probably benign	Het
Zbtb38	T	C	9: 96,685,462	K1190E	probably benign	Het
Zc3h6	T	C	2: 129,017,358	V1103A	probably benign	Het
Zfp407	G	A	18: 84,562,157	T277I	probably damaging	Het
Zfp804b	A	G	5: 6,769,509	S1149P	probably damaging	Het

Other mutations in Myo9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Myo9a	APN	9	59843059	splice site	probably benign
IGL00510:Myo9a	APN	9	59832181	splice site	probably benign
IGL00710:Myo9a	APN	9	59875311	missense	probably damaging	1.00
IGL00963:Myo9a	APN	9	59900372	missense	probably damaging	0.98
IGL01087:Myo9a	APN	9	59790078	missense	possibly damaging	0.93
IGL01145:Myo9a	APN	9	59855375	missense	probably benign	0.18
IGL01403:Myo9a	APN	9	59871563	missense	probably damaging	0.98
IGL01528:Myo9a	APN	9	59779674	missense	probably damaging	1.00
IGL01608:Myo9a	APN	9	59870836	nonsense	probably null
IGL01701:Myo9a	APN	9	59884594	critical splice donor site	probably null
IGL01918:Myo9a	APN	9	59779702	missense	probably damaging	1.00
IGL02026:Myo9a	APN	9	59905962	missense	probably damaging	0.99
IGL02139:Myo9a	APN	9	59779992	missense	probably benign	0.07
IGL02176:Myo9a	APN	9	59870553	missense	probably benign	0.45
IGL02272:Myo9a	APN	9	59884600	splice site	probably benign
IGL02283:Myo9a	APN	9	59871673	missense	probably benign	0.00
IGL02499:Myo9a	APN	9	59815386	splice site	probably benign
IGL02652:Myo9a	APN	9	59863928	missense	probably damaging	1.00
IGL02666:Myo9a	APN	9	59924904	missense	probably benign	0.02
IGL02878:Myo9a	APN	9	59908300	critical splice donor site	probably null
IGL02982:Myo9a	APN	9	59908208	nonsense	probably null
IGL03072:Myo9a	APN	9	59809442	missense	possibly damaging	0.83
IGL03090:Myo9a	APN	9	59894135	splice site	probably benign
IGL03111:Myo9a	APN	9	59827243	missense	probably benign	0.19
IGL03389:Myo9a	APN	9	59869607	missense	probably damaging	1.00
essentials	UTSW	9	59894866	missense	probably benign	0.09
necessities	UTSW	9	59815334	missense	probably damaging	1.00
PIT4402001:Myo9a	UTSW	9	59870436	missense	possibly damaging	0.83
R0013:Myo9a	UTSW	9	59860206	splice site	probably benign
R0013:Myo9a	UTSW	9	59860206	splice site	probably benign
R0018:Myo9a	UTSW	9	59871724	missense	probably benign	0.00
R0018:Myo9a	UTSW	9	59871724	missense	probably benign	0.00
R0329:Myo9a	UTSW	9	59923677	missense	probably damaging	1.00
R0423:Myo9a	UTSW	9	59895336	missense	probably damaging	1.00
R0521:Myo9a	UTSW	9	59894352	missense	probably damaging	1.00
R0607:Myo9a	UTSW	9	59921793	missense	probably benign	0.02
R0652:Myo9a	UTSW	9	59871926	missense	probably benign
R0653:Myo9a	UTSW	9	59924991	missense	probably damaging	1.00
R0723:Myo9a	UTSW	9	59871100	missense	probably benign	0.01
R0784:Myo9a	UTSW	9	59896545	splice site	probably benign
R0842:Myo9a	UTSW	9	59871067	missense	probably benign	0.02
R1055:Myo9a	UTSW	9	59855370	missense	probably benign	0.01
R1056:Myo9a	UTSW	9	59832201	missense	possibly damaging	0.64
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1615:Myo9a	UTSW	9	59788456	missense	possibly damaging	0.68
R1715:Myo9a	UTSW	9	59832300	missense	probably damaging	0.99
R1981:Myo9a	UTSW	9	59894146	missense	probably benign
R2228:Myo9a	UTSW	9	59894180	missense	probably benign	0.06
R2272:Myo9a	UTSW	9	59815301	missense	probably damaging	1.00
R2327:Myo9a	UTSW	9	59779765	missense	probably benign	0.11
R2990:Myo9a	UTSW	9	59924889	missense	possibly damaging	0.95
R3161:Myo9a	UTSW	9	59832315	splice site	probably benign
R3721:Myo9a	UTSW	9	59868180	missense	probably benign
R3928:Myo9a	UTSW	9	59895283	missense	probably damaging	1.00
R4197:Myo9a	UTSW	9	59894866	missense	probably benign	0.09
R4212:Myo9a	UTSW	9	59906066	nonsense	probably null
R4610:Myo9a	UTSW	9	59871882	missense	probably benign
R4616:Myo9a	UTSW	9	59821649	missense	probably damaging	1.00
R4621:Myo9a	UTSW	9	59871072	missense	probably benign	0.00
R4623:Myo9a	UTSW	9	59871072	missense	probably benign	0.00
R4632:Myo9a	UTSW	9	59869664	missense	probably benign	0.00
R4657:Myo9a	UTSW	9	59875416	critical splice donor site	probably null
R4892:Myo9a	UTSW	9	59824242	missense	probably damaging	0.98
R4897:Myo9a	UTSW	9	59896517	missense	probably benign	0.07
R4966:Myo9a	UTSW	9	59871734	missense	probably benign	0.00
R4993:Myo9a	UTSW	9	59861472	nonsense	probably null
R5160:Myo9a	UTSW	9	59871802	missense	probably benign	0.24
R5233:Myo9a	UTSW	9	59910617	missense	probably damaging	1.00
R5271:Myo9a	UTSW	9	59907382	missense	probably damaging	1.00
R5308:Myo9a	UTSW	9	59863961	missense	probably damaging	1.00
R5367:Myo9a	UTSW	9	59900449	missense	probably damaging	0.96
R5432:Myo9a	UTSW	9	59865670	missense	possibly damaging	0.94
R5459:Myo9a	UTSW	9	59884520	missense	probably damaging	0.98
R5511:Myo9a	UTSW	9	59780212	missense	probably damaging	1.00
R5568:Myo9a	UTSW	9	59874628	missense	probably benign
R5573:Myo9a	UTSW	9	59871001	missense	probably benign
R5589:Myo9a	UTSW	9	59895244	nonsense	probably null
R5607:Myo9a	UTSW	9	59863944	missense	probably damaging	1.00
R5633:Myo9a	UTSW	9	59868184	missense	possibly damaging	0.60
R5885:Myo9a	UTSW	9	59871220	missense	probably benign
R6024:Myo9a	UTSW	9	59855388	missense	possibly damaging	0.68
R6086:Myo9a	UTSW	9	59790057	nonsense	probably null
R6146:Myo9a	UTSW	9	59871229	missense	probably benign	0.01
R6194:Myo9a	UTSW	9	59869750	missense	probably benign	0.00
R6213:Myo9a	UTSW	9	59827258	missense	probably damaging	1.00
R6368:Myo9a	UTSW	9	59924948	missense	probably benign	0.01
R6550:Myo9a	UTSW	9	59868199	missense	probably damaging	1.00
R6612:Myo9a	UTSW	9	59827196	missense	probably damaging	1.00
R6665:Myo9a	UTSW	9	59871872	missense	probably benign	0.09
R6951:Myo9a	UTSW	9	59894768	missense	probably damaging	1.00
R7026:Myo9a	UTSW	9	59815334	missense	probably damaging	1.00
R7107:Myo9a	UTSW	9	59870815	missense	probably benign	0.44
R7310:Myo9a	UTSW	9	59871153	missense	probably benign	0.08
R7473:Myo9a	UTSW	9	59895244	missense	probably benign	0.31
R7723:Myo9a	UTSW	9	59779858	missense	probably damaging	1.00
R7823:Myo9a	UTSW	9	59811950	missense	probably damaging	1.00
R7824:Myo9a	UTSW	9	59860109	missense	probably damaging	1.00
R7965:Myo9a	UTSW	9	59788438	missense	probably damaging	1.00
R8031:Myo9a	UTSW	9	59780091	missense	probably benign	0.33
R8055:Myo9a	UTSW	9	59907460	missense	probably damaging	1.00
R8071:Myo9a	UTSW	9	59874648	missense	probably benign
R8250:Myo9a	UTSW	9	59860109	missense	probably damaging	1.00
R8260:Myo9a	UTSW	9	59910678	missense	probably benign	0.08
R8355:Myo9a	UTSW	9	59909847	missense	probably damaging	1.00
R8432:Myo9a	UTSW	9	59780265	missense	probably damaging	1.00
R8470:Myo9a	UTSW	9	59832290	missense	probably damaging	1.00
R8528:Myo9a	UTSW	9	59860140	missense	probably damaging	1.00
R8681:Myo9a	UTSW	9	59868111	missense	probably benign	0.16
R8690:Myo9a	UTSW	9	59875374	missense	probably benign
R8793:Myo9a	UTSW	9	59884567	missense	probably benign	0.03
R8812:Myo9a	UTSW	9	59779747	missense	probably benign	0.14
R9016:Myo9a	UTSW	9	59868144	nonsense	probably null
R9026:Myo9a	UTSW	9	59809474	missense	probably damaging	0.96
R9036:Myo9a	UTSW	9	59780301	nonsense	probably null
R9130:Myo9a	UTSW	9	59832231	missense	probably damaging	0.98
R9131:Myo9a	UTSW	9	59861489	missense	probably damaging	1.00
R9213:Myo9a	UTSW	9	59865639	missense	probably benign	0.04
R9498:Myo9a	UTSW	9	59827183	missense	probably damaging	1.00
R9575:Myo9a	UTSW	9	59905907	missense	probably damaging	1.00
RF018:Myo9a	UTSW	9	59869586	missense	probably benign	0.00
RF019:Myo9a	UTSW	9	59921772	missense	probably benign	0.00
Z1176:Myo9a	UTSW	9	59895259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGCTTTGTTTGCATTTCTGCCATTAC -3'
(R):5'- GTCAGACTACTTATCCAAGGACACCTCA -3'

Sequencing Primer
(F):5'- CATGTGTTCTCTGAAAGCTTACCAC -3'
(R):5'- aggagaaaagggtggtaggg -3'

Posted On

2014-05-14