Mutagenetix > Incidental Mutations

Incidental Mutation 'R1698:Rasa2'

192421

Institutional Source

Beutler Lab

Gene Symbol

Rasa2

Ensembl Gene

ENSMUSG00000032413

Gene Name

RAS p21 protein activator 2

Synonyms

GAP1m, 5430433H21Rik

MMRRC Submission

039731-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.142) question?

Stock #

R1698 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

96539300-96631617 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 96568375 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 490 (K490R)

Ref Sequence

ENSEMBL: ENSMUSP00000034984 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034984] [ENSMUST00000128346]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034984
AA Change: K490R

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000034984
Gene: ENSMUSG00000032413
AA Change: K490R

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
C2	38	136	3.78e-16	SMART
C2	171	287	8.48e-19	SMART
RasGAP	300	641	7.05e-140	SMART
PH	604	706	1.98e-17	SMART
BTK	706	742	1.39e-18	SMART
low complexity region	824	838	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000128346

SMART Domains

Protein: ENSMUSP00000115629
Gene: ENSMUSG00000032413

Domain	Start	End	E-Value	Type
C2	3	79	6.86e-5	SMART
C2	114	230	8.48e-19	SMART
RasGAP	243	584	7.05e-140	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144376

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185435

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190537

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	C	6: 121,645,158	E340A	possibly damaging	Het
Abca13	A	G	11: 9,314,507	D2963G	probably benign	Het
Actn3	T	C	19: 4,862,207	D783G	possibly damaging	Het
Adamtsl2	A	G	2: 27,103,127	E723G	possibly damaging	Het
Agrn	G	T	4: 156,166,558	Q1931K	probably benign	Het
Ankrd27	G	A	7: 35,614,521	A426T	probably benign	Het
Atg9b	C	A	5: 24,388,188	G406C	probably damaging	Het
BC005561	C	T	5: 104,520,510	A966V	probably benign	Het
C1ra	A	T	6: 124,522,766	Q637L	probably benign	Het
Cdhr2	A	T	13: 54,719,581	M438L	probably benign	Het
Cep350	T	C	1: 155,953,358	I267V	possibly damaging	Het
Chrna5	A	G	9: 55,004,642	Y138C	probably damaging	Het
Chst3	T	A	10: 60,185,703	M441L	probably benign	Het
Cmya5	G	A	13: 93,063,519	P3434S	probably benign	Het
Cog2	T	A	8: 124,525,683	L42Q	probably damaging	Het
Cpq	A	T	15: 33,250,126	I210F	probably benign	Het
Crnn	C	A	3: 93,148,458	Q184K	probably damaging	Het
Csnka2ip	A	T	16: 64,478,059	Y647*	probably null	Het
D5Ertd579e	C	T	5: 36,604,530	R1331H	probably benign	Het
Dennd5a	C	T	7: 109,917,380		probably null	Het
Dync1h1	A	G	12: 110,626,992	Q1231R	possibly damaging	Het
Erbin	T	A	13: 103,833,731	I1126F	possibly damaging	Het
Fastkd1	T	C	2: 69,702,469	D518G	probably benign	Het
Gcc1	A	G	6: 28,421,111	L69P	possibly damaging	Het
Gkn1	T	C	6: 87,347,169	Y119C	probably damaging	Het
Gmpr	T	G	13: 45,517,044	W81G	probably benign	Het
Gyg	T	A	3: 20,138,051	I236F	probably benign	Het
Hcrtr2	T	C	9: 76,246,453	Y219C	probably damaging	Het
Hmcn1	G	A	1: 150,565,369	Q5379*	probably null	Het
Kank1	T	C	19: 25,411,317	C785R	probably benign	Het
Lrp1b	A	T	2: 40,851,806	C3036*	probably null	Het
Mdga2	T	C	12: 66,689,335	D373G	probably damaging	Het
Mgat2	A	T	12: 69,185,719	I356F	probably benign	Het
Miga2	A	G	2: 30,377,997	D346G	probably damaging	Het
Mprip	T	A	11: 59,760,258	L1596Q	possibly damaging	Het
Mroh2b	G	A	15: 4,914,140	R386Q	probably benign	Het
Mst1r	T	A	9: 107,919,980	S1349R	probably benign	Het
Mtmr3	C	T	11: 4,492,825	R403H	possibly damaging	Het
Mycbpap	G	A	11: 94,508,143	Q460*	probably null	Het
Myo9a	T	C	9: 59,868,181	V1025A	probably benign	Het
Ncapd2	C	T	6: 125,168,590	E1365K	probably null	Het
Nkiras2	C	A	11: 100,625,163	D105E	probably damaging	Het
Nolc1	T	G	19: 46,081,431		probably null	Het
Nos1	T	C	5: 117,867,232	F6L	probably benign	Het
Olfr1112	G	T	2: 87,191,737	V17L	probably benign	Het
Olfr1278	T	A	2: 111,292,560	C97*	probably null	Het
Olfr1369-ps1	C	T	13: 21,116,565	T291I	probably benign	Het
Olfr218	A	T	1: 173,203,371	N5I	probably damaging	Het
Olfr325	T	C	11: 58,581,251	Y136H	probably damaging	Het
Olfr910	T	A	9: 38,539,256	Y120*	probably null	Het
Pfkm	A	G	15: 98,128,318	E598G	possibly damaging	Het
Phf2	A	T	13: 48,807,630	D861E	unknown	Het
Polr2a	A	G	11: 69,739,877		probably null	Het
Popdc2	G	A	16: 38,369,491	V167M	probably damaging	Het
Ptpn22	T	C	3: 103,885,798	S422P	probably benign	Het
Rbfox3	T	A	11: 118,495,221	D286V	probably damaging	Het
Rdh13	A	G	7: 4,427,791	W223R	probably damaging	Het
Riok3	T	C	18: 12,128,929	S7P	probably benign	Het
Rnaseh2b	A	G	14: 62,353,632	E144G	probably benign	Het
Rnf20	C	T	4: 49,651,498	Q655*	probably null	Het
Rpap2	T	C	5: 107,603,550	Y8H	probably damaging	Het
Slc5a10	T	C	11: 61,709,602	Y181C	probably benign	Het
Snd1	G	T	6: 28,888,253	G896*	probably null	Het
Spast	C	T	17: 74,356,160	Q158*	probably null	Het
Tas2r104	G	A	6: 131,685,584	S54F	probably damaging	Het
Tcaf2	C	T	6: 42,628,017	W611*	probably null	Het
Timp4	G	A	6: 115,250,403		probably null	Het
Tmem45a	G	A	16: 56,823,570	S72L	probably benign	Het
Tnrc18	T	C	5: 142,788,703	T124A	possibly damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Ttn	T	C	2: 76,942,915	D2381G	probably damaging	Het
Uevld	T	C	7: 46,955,624	T41A	possibly damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Unc5d	T	C	8: 28,696,478	E527G	probably damaging	Het
Vmn2r125	C	T	4: 156,351,038	T237I	probably benign	Het
Vmn2r63	A	C	7: 42,933,614	I59S	probably benign	Het
Vps72	G	A	3: 95,118,695	S106N	probably benign	Het
Zan	A	C	5: 137,409,669		probably benign	Het
Zbtb38	T	C	9: 96,685,462	K1190E	probably benign	Het
Zc3h6	T	C	2: 129,017,358	V1103A	probably benign	Het
Zfp407	G	A	18: 84,562,157	T277I	probably damaging	Het
Zfp804b	A	G	5: 6,769,509	S1149P	probably damaging	Het

Other mutations in Rasa2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Rasa2	APN	9	96544860	missense	probably damaging	1.00
IGL00661:Rasa2	APN	9	96577553	splice site	probably benign
IGL00825:Rasa2	APN	9	96570719	missense	probably benign	0.37
IGL01645:Rasa2	APN	9	96582781	nonsense	probably null
IGL02260:Rasa2	APN	9	96544319	missense	probably benign	0.08
IGL02568:Rasa2	APN	9	96580510	missense	probably damaging	1.00
IGL02963:Rasa2	APN	9	96570785	missense	probably damaging	1.00
R0018:Rasa2	UTSW	9	96571963	missense	probably damaging	1.00
R0018:Rasa2	UTSW	9	96571963	missense	probably damaging	1.00
R0144:Rasa2	UTSW	9	96592019	missense	probably damaging	0.99
R0238:Rasa2	UTSW	9	96568407	missense	probably damaging	1.00
R0238:Rasa2	UTSW	9	96568407	missense	probably damaging	1.00
R0295:Rasa2	UTSW	9	96545810	splice site	probably null
R0332:Rasa2	UTSW	9	96606176	missense	probably damaging	1.00
R0348:Rasa2	UTSW	9	96571959	missense	probably damaging	1.00
R0931:Rasa2	UTSW	9	96552404	missense	possibly damaging	0.88
R1067:Rasa2	UTSW	9	96552323	missense	probably damaging	1.00
R1485:Rasa2	UTSW	9	96544348	missense	probably benign	0.00
R1562:Rasa2	UTSW	9	96545750	missense	possibly damaging	0.89
R1980:Rasa2	UTSW	9	96570768	missense	probably damaging	0.99
R3055:Rasa2	UTSW	9	96611473	missense	possibly damaging	0.77
R4175:Rasa2	UTSW	9	96560777	missense	probably benign	0.01
R4258:Rasa2	UTSW	9	96557380	intron	probably benign
R4432:Rasa2	UTSW	9	96542407	unclassified	probably benign
R4636:Rasa2	UTSW	9	96544337	missense	probably benign
R4773:Rasa2	UTSW	9	96544417	missense	probably benign
R4990:Rasa2	UTSW	9	96591989	missense	probably benign	0.24
R5177:Rasa2	UTSW	9	96544791	nonsense	probably null
R5462:Rasa2	UTSW	9	96571918	missense	probably damaging	1.00
R5737:Rasa2	UTSW	9	96570665	critical splice donor site	probably null
R5775:Rasa2	UTSW	9	96577468	splice site	probably null
R5866:Rasa2	UTSW	9	96545770	missense	probably benign	0.00
R5938:Rasa2	UTSW	9	96611389	missense	possibly damaging	0.50
R6076:Rasa2	UTSW	9	96545646	missense	probably benign
R6216:Rasa2	UTSW	9	96544304	missense	probably damaging	1.00
R6743:Rasa2	UTSW	9	96611440	missense	probably damaging	1.00
R6982:Rasa2	UTSW	9	96560750	missense	probably damaging	1.00
R7350:Rasa2	UTSW	9	96544355	missense	probably benign	0.16
R7405:Rasa2	UTSW	9	96566027	missense	probably benign	0.09
R7421:Rasa2	UTSW	9	96611447	missense	unknown
R7490:Rasa2	UTSW	9	96566122	missense	possibly damaging	0.48
R7515:Rasa2	UTSW	9	96552300	splice site	probably null
R7547:Rasa2	UTSW	9	96611421	missense	probably damaging	1.00
R7557:Rasa2	UTSW	9	96557425	missense	probably damaging	0.98
R7821:Rasa2	UTSW	9	96580484	splice site	probably null
R7894:Rasa2	UTSW	9	96602727	missense	probably benign	0.13
R8089:Rasa2	UTSW	9	96553124	missense	probably benign	0.00
R8193:Rasa2	UTSW	9	96602738	missense	probably damaging	0.97
RF017:Rasa2	UTSW	9	96631468	small insertion	probably benign
RF029:Rasa2	UTSW	9	96631467	small insertion	probably benign
RF047:Rasa2	UTSW	9	96631467	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- GCAAGATCATCCTATGGATTGTGGGAC -3'
(R):5'- CCTTTAACCTGAGTTGGGACTAGAAGC -3'

Sequencing Primer
(F):5'- ATAGCTGGTACACACGGGTTTATTC -3'
(R):5'- TGTTCTCATGAAGATATTGAAGCTG -3'

Posted On

2014-05-14