Mutagenetix > Incidental Mutation

Incidental Mutation 'R1698:Mst1r'

192423

Institutional Source

Beutler Lab

Gene Symbol

Mst1r

Ensembl Gene

ENSMUSG00000032584

Gene Name

macrophage stimulating 1 receptor (c-met-related tyrosine kinase)

Synonyms

Fv-2, Ron, CDw136, Fv2, friend virus susceptibility 2, PTK8, STK

MMRRC Submission

039731-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.250) question?

Stock #

R1698 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

107906873-107920383 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 107919980 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1349 (S1349R)

Ref Sequence

ENSEMBL: ENSMUSP00000035203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035203] [ENSMUST00000195617]

AlphaFold

Q62190

Predicted Effect

probably benign
Transcript: ENSMUST00000035203
AA Change: S1349R

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584
AA Change: S1349R

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	510	9.03e-116	SMART
PSI	528	570	8.72e-4	SMART
IPT	570	684	1.63e-18	SMART
IPT	685	769	4.03e-23	SMART
IPT	771	873	8.41e-12	SMART
IPT	878	972	5.36e0	SMART
TyrKc	1059	1318	8.2e-134	SMART
low complexity region	1349	1360	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194527

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195113

Predicted Effect

probably benign
Transcript: ENSMUST00000195617

SMART Domains

Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	442	3.5e-63	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	C	6: 121,645,158	E340A	possibly damaging	Het
Abca13	A	G	11: 9,314,507	D2963G	probably benign	Het
Actn3	T	C	19: 4,862,207	D783G	possibly damaging	Het
Adamtsl2	A	G	2: 27,103,127	E723G	possibly damaging	Het
Agrn	G	T	4: 156,166,558	Q1931K	probably benign	Het
Ankrd27	G	A	7: 35,614,521	A426T	probably benign	Het
Atg9b	C	A	5: 24,388,188	G406C	probably damaging	Het
BC005561	C	T	5: 104,520,510	A966V	probably benign	Het
C1ra	A	T	6: 124,522,766	Q637L	probably benign	Het
Cdhr2	A	T	13: 54,719,581	M438L	probably benign	Het
Cep350	T	C	1: 155,953,358	I267V	possibly damaging	Het
Chrna5	A	G	9: 55,004,642	Y138C	probably damaging	Het
Chst3	T	A	10: 60,185,703	M441L	probably benign	Het
Cmya5	G	A	13: 93,063,519	P3434S	probably benign	Het
Cog2	T	A	8: 124,525,683	L42Q	probably damaging	Het
Cpq	A	T	15: 33,250,126	I210F	probably benign	Het
Crnn	C	A	3: 93,148,458	Q184K	probably damaging	Het
Csnka2ip	A	T	16: 64,478,059	Y647*	probably null	Het
D5Ertd579e	C	T	5: 36,604,530	R1331H	probably benign	Het
Dennd5a	C	T	7: 109,917,380		probably null	Het
Dync1h1	A	G	12: 110,626,992	Q1231R	possibly damaging	Het
Erbin	T	A	13: 103,833,731	I1126F	possibly damaging	Het
Fastkd1	T	C	2: 69,702,469	D518G	probably benign	Het
Gcc1	A	G	6: 28,421,111	L69P	possibly damaging	Het
Gkn1	T	C	6: 87,347,169	Y119C	probably damaging	Het
Gmpr	T	G	13: 45,517,044	W81G	probably benign	Het
Gyg	T	A	3: 20,138,051	I236F	probably benign	Het
Hcrtr2	T	C	9: 76,246,453	Y219C	probably damaging	Het
Hmcn1	G	A	1: 150,565,369	Q5379*	probably null	Het
Kank1	T	C	19: 25,411,317	C785R	probably benign	Het
Lrp1b	A	T	2: 40,851,806	C3036*	probably null	Het
Mdga2	T	C	12: 66,689,335	D373G	probably damaging	Het
Mgat2	A	T	12: 69,185,719	I356F	probably benign	Het
Miga2	A	G	2: 30,377,997	D346G	probably damaging	Het
Mprip	T	A	11: 59,760,258	L1596Q	possibly damaging	Het
Mroh2b	G	A	15: 4,914,140	R386Q	probably benign	Het
Mtmr3	C	T	11: 4,492,825	R403H	possibly damaging	Het
Mycbpap	G	A	11: 94,508,143	Q460*	probably null	Het
Myo9a	T	C	9: 59,868,181	V1025A	probably benign	Het
Ncapd2	C	T	6: 125,168,590	E1365K	probably null	Het
Nkiras2	C	A	11: 100,625,163	D105E	probably damaging	Het
Nolc1	T	G	19: 46,081,431		probably null	Het
Nos1	T	C	5: 117,867,232	F6L	probably benign	Het
Olfr1112	G	T	2: 87,191,737	V17L	probably benign	Het
Olfr1278	T	A	2: 111,292,560	C97*	probably null	Het
Olfr1369-ps1	C	T	13: 21,116,565	T291I	probably benign	Het
Olfr218	A	T	1: 173,203,371	N5I	probably damaging	Het
Olfr325	T	C	11: 58,581,251	Y136H	probably damaging	Het
Olfr910	T	A	9: 38,539,256	Y120*	probably null	Het
Pfkm	A	G	15: 98,128,318	E598G	possibly damaging	Het
Phf2	A	T	13: 48,807,630	D861E	unknown	Het
Polr2a	A	G	11: 69,739,877		probably null	Het
Popdc2	G	A	16: 38,369,491	V167M	probably damaging	Het
Ptpn22	T	C	3: 103,885,798	S422P	probably benign	Het
Rasa2	T	C	9: 96,568,375	K490R	possibly damaging	Het
Rbfox3	T	A	11: 118,495,221	D286V	probably damaging	Het
Rdh13	A	G	7: 4,427,791	W223R	probably damaging	Het
Riok3	T	C	18: 12,128,929	S7P	probably benign	Het
Rnaseh2b	A	G	14: 62,353,632	E144G	probably benign	Het
Rnf20	C	T	4: 49,651,498	Q655*	probably null	Het
Rpap2	T	C	5: 107,603,550	Y8H	probably damaging	Het
Slc5a10	T	C	11: 61,709,602	Y181C	probably benign	Het
Snd1	G	T	6: 28,888,253	G896*	probably null	Het
Spast	C	T	17: 74,356,160	Q158*	probably null	Het
Tas2r104	G	A	6: 131,685,584	S54F	probably damaging	Het
Tcaf2	C	T	6: 42,628,017	W611*	probably null	Het
Timp4	G	A	6: 115,250,403		probably null	Het
Tmem45a	G	A	16: 56,823,570	S72L	probably benign	Het
Tnrc18	T	C	5: 142,788,703	T124A	possibly damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Ttn	T	C	2: 76,942,915	D2381G	probably damaging	Het
Uevld	T	C	7: 46,955,624	T41A	possibly damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Unc5d	T	C	8: 28,696,478	E527G	probably damaging	Het
Vmn2r125	C	T	4: 156,351,038	T237I	probably benign	Het
Vmn2r63	A	C	7: 42,933,614	I59S	probably benign	Het
Vps72	G	A	3: 95,118,695	S106N	probably benign	Het
Zan	A	C	5: 137,409,669		probably benign	Het
Zbtb38	T	C	9: 96,685,462	K1190E	probably benign	Het
Zc3h6	T	C	2: 129,017,358	V1103A	probably benign	Het
Zfp407	G	A	18: 84,562,157	T277I	probably damaging	Het
Zfp804b	A	G	5: 6,769,509	S1149P	probably damaging	Het

Other mutations in Mst1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Mst1r	APN	9	107913250	splice site	probably benign
IGL01327:Mst1r	APN	9	107907844	missense	probably benign	0.03
IGL01572:Mst1r	APN	9	107911592	missense	probably damaging	1.00
IGL01968:Mst1r	APN	9	107916806	splice site	probably null
IGL01983:Mst1r	APN	9	107917276	missense	probably damaging	0.99
IGL02096:Mst1r	APN	9	107917279	missense	probably damaging	0.97
IGL02203:Mst1r	APN	9	107913149	missense	possibly damaging	0.61
IGL02203:Mst1r	APN	9	107907869	missense	probably damaging	1.00
IGL02332:Mst1r	APN	9	107907826	nonsense	probably null
IGL02402:Mst1r	APN	9	107916827	missense	probably damaging	0.99
IGL02404:Mst1r	APN	9	107913067	splice site	probably benign
IGL02942:Mst1r	APN	9	107913153	missense	possibly damaging	0.89
IGL02951:Mst1r	APN	9	107908204	missense	possibly damaging	0.88
IGL02975:Mst1r	APN	9	107913180	missense	probably benign	0.20
IGL03005:Mst1r	APN	9	107914549	nonsense	probably null
IGL03304:Mst1r	APN	9	107907938	missense	probably damaging	1.00
R0386:Mst1r	UTSW	9	107916804	splice site	probably null
R0833:Mst1r	UTSW	9	107913167	missense	probably benign
R0833:Mst1r	UTSW	9	107914776	missense	probably benign	0.00
R1139:Mst1r	UTSW	9	107919969	missense	possibly damaging	0.93
R1371:Mst1r	UTSW	9	107917225	missense	probably damaging	1.00
R1477:Mst1r	UTSW	9	107908324	missense	probably benign
R1479:Mst1r	UTSW	9	107913345	splice site	probably benign
R1541:Mst1r	UTSW	9	107917363	missense	probably damaging	0.99
R1891:Mst1r	UTSW	9	107913462	missense	probably damaging	1.00
R1971:Mst1r	UTSW	9	107913212	missense	probably benign	0.06
R1974:Mst1r	UTSW	9	107914763	missense	probably damaging	1.00
R1974:Mst1r	UTSW	9	107915933	critical splice donor site	probably null
R2144:Mst1r	UTSW	9	107913168	missense	probably benign
R2221:Mst1r	UTSW	9	107908348	missense	probably damaging	1.00
R2356:Mst1r	UTSW	9	107917870	missense	probably damaging	1.00
R3913:Mst1r	UTSW	9	107914746	missense	probably benign
R4768:Mst1r	UTSW	9	107911650	missense	probably damaging	1.00
R4793:Mst1r	UTSW	9	107919925	missense	probably damaging	0.96
R5141:Mst1r	UTSW	9	107912241	missense	probably damaging	0.99
R5191:Mst1r	UTSW	9	107911551	missense	probably damaging	0.98
R5238:Mst1r	UTSW	9	107907574	missense	probably damaging	1.00
R6024:Mst1r	UTSW	9	107908151	missense	probably benign	0.00
R6220:Mst1r	UTSW	9	107907348	missense	probably benign	0.11
R6256:Mst1r	UTSW	9	107917266	missense	probably damaging	1.00
R6361:Mst1r	UTSW	9	107915853	missense	probably benign
R6522:Mst1r	UTSW	9	107913239	missense	probably benign	0.00
R6559:Mst1r	UTSW	9	107908271	missense	possibly damaging	0.91
R6863:Mst1r	UTSW	9	107920026	missense	probably benign
R6868:Mst1r	UTSW	9	107915933	critical splice donor site	probably null
R6873:Mst1r	UTSW	9	107911644	missense	possibly damaging	0.90
R6978:Mst1r	UTSW	9	107912594	missense	probably benign	0.23
R7168:Mst1r	UTSW	9	107908193	missense	probably benign	0.01
R7299:Mst1r	UTSW	9	107914790	missense	possibly damaging	0.46
R7301:Mst1r	UTSW	9	107914790	missense	possibly damaging	0.46
R7405:Mst1r	UTSW	9	107915122	missense	possibly damaging	0.87
R7615:Mst1r	UTSW	9	107920012	missense	probably benign	0.05
R7684:Mst1r	UTSW	9	107911563	missense	probably benign	0.01
R7741:Mst1r	UTSW	9	107907120	start gained	probably benign
R7916:Mst1r	UTSW	9	107907578	missense	probably damaging	1.00
R7987:Mst1r	UTSW	9	107912798	splice site	probably null
R8177:Mst1r	UTSW	9	107907585	missense	probably damaging	1.00
R8356:Mst1r	UTSW	9	107917264	missense	probably damaging	1.00
R8494:Mst1r	UTSW	9	107914519	missense	possibly damaging	0.90
R8692:Mst1r	UTSW	9	107914851	missense	possibly damaging	0.82
R8979:Mst1r	UTSW	9	107915279	missense	probably damaging	0.98
R9012:Mst1r	UTSW	9	107914761	missense	probably benign	0.01
X0026:Mst1r	UTSW	9	107913203	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TTACCCCGTGAACCTAGAGCTGTG -3'
(R):5'- TTCAGTGGCCCCAGAAAGCTAAAG -3'

Sequencing Primer
(F):5'- caaggaacatacccgaaatcac -3'
(R):5'- CCATGCTGAGGCTTGTCC -3'

Posted On

2014-05-14