Incidental Mutation 'R1698:Mprip'
ID 192429
Institutional Source Beutler Lab
Gene Symbol Mprip
Ensembl Gene ENSMUSG00000005417
Gene Name myosin phosphatase Rho interacting protein
Synonyms p116 Rho interacting protein, p116Rip, Gm34094, RIP3, Rhoip3
MMRRC Submission 039731-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.523) question?
Stock # R1698 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 59552973-59671686 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59651084 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 1596 (L1596Q)
Ref Sequence ENSEMBL: ENSMUSP00000071081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066330] [ENSMUST00000072031] [ENSMUST00000108751] [ENSMUST00000116371] [ENSMUST00000133861]
AlphaFold P97434
Predicted Effect possibly damaging
Transcript: ENSMUST00000066330
AA Change: L1596Q

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000071081
Gene: ENSMUSG00000005417
AA Change: L1596Q

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 249 320 1e-10 BLAST
PH 351 448 3.76e-18 SMART
low complexity region 492 501 N/A INTRINSIC
low complexity region 536 555 N/A INTRINSIC
coiled coil region 636 671 N/A INTRINSIC
Blast:PAC 806 848 2e-10 BLAST
low complexity region 1005 1023 N/A INTRINSIC
low complexity region 1047 1059 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1183 1200 N/A INTRINSIC
coiled coil region 1267 1300 N/A INTRINSIC
coiled coil region 1617 1642 N/A INTRINSIC
coiled coil region 1729 1779 N/A INTRINSIC
coiled coil region 1899 1936 N/A INTRINSIC
coiled coil region 1960 2110 N/A INTRINSIC
coiled coil region 2132 2206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072031
SMART Domains Protein: ENSMUSP00000071914
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 254 320 1e-10 BLAST
PH 387 484 3.76e-18 SMART
low complexity region 528 537 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
coiled coil region 672 707 N/A INTRINSIC
coiled coil region 728 878 N/A INTRINSIC
coiled coil region 900 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108751
SMART Domains Protein: ENSMUSP00000104382
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 183 196 N/A INTRINSIC
Blast:PH 216 282 1e-10 BLAST
PH 349 446 3.76e-18 SMART
low complexity region 490 499 N/A INTRINSIC
low complexity region 534 553 N/A INTRINSIC
coiled coil region 634 669 N/A INTRINSIC
coiled coil region 690 840 N/A INTRINSIC
coiled coil region 862 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116371
SMART Domains Protein: ENSMUSP00000112072
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 254 320 1e-10 BLAST
PH 387 484 3.76e-18 SMART
low complexity region 528 537 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
coiled coil region 672 707 N/A INTRINSIC
coiled coil region 728 878 N/A INTRINSIC
coiled coil region 900 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132620
SMART Domains Protein: ENSMUSP00000119422
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
Blast:PH 101 167 9e-11 BLAST
PH 198 295 3.76e-18 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 383 402 N/A INTRINSIC
coiled coil region 482 517 N/A INTRINSIC
coiled coil region 538 688 N/A INTRINSIC
coiled coil region 710 784 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133861
SMART Domains Protein: ENSMUSP00000119562
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
low complexity region 89 102 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
PH 373 470 3.76e-18 SMART
low complexity region 514 523 N/A INTRINSIC
low complexity region 558 577 N/A INTRINSIC
coiled coil region 658 693 N/A INTRINSIC
coiled coil region 714 864 N/A INTRINSIC
coiled coil region 886 960 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156111
SMART Domains Protein: ENSMUSP00000114446
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
internal_repeat_1 5 38 1.61e-7 PROSPERO
internal_repeat_2 9 51 2.4e-6 PROSPERO
internal_repeat_1 59 92 1.61e-7 PROSPERO
internal_repeat_2 85 129 2.4e-6 PROSPERO
coiled coil region 140 177 N/A INTRINSIC
coiled coil region 201 351 N/A INTRINSIC
coiled coil region 373 447 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,622,117 (GRCm39) E340A possibly damaging Het
Abca13 A G 11: 9,264,507 (GRCm39) D2963G probably benign Het
Actn3 T C 19: 4,912,235 (GRCm39) D783G possibly damaging Het
Adamtsl2 A G 2: 26,993,139 (GRCm39) E723G possibly damaging Het
Agrn G T 4: 156,251,015 (GRCm39) Q1931K probably benign Het
Ankrd27 G A 7: 35,313,946 (GRCm39) A426T probably benign Het
Atg9b C A 5: 24,593,186 (GRCm39) G406C probably damaging Het
C1ra A T 6: 124,499,725 (GRCm39) Q637L probably benign Het
Cdhr2 A T 13: 54,867,394 (GRCm39) M438L probably benign Het
Cep350 T C 1: 155,829,104 (GRCm39) I267V possibly damaging Het
Chrna5 A G 9: 54,911,926 (GRCm39) Y138C probably damaging Het
Chst3 T A 10: 60,021,525 (GRCm39) M441L probably benign Het
Cmya5 G A 13: 93,200,027 (GRCm39) P3434S probably benign Het
Cog2 T A 8: 125,252,422 (GRCm39) L42Q probably damaging Het
Cpq A T 15: 33,250,272 (GRCm39) I210F probably benign Het
Crnn C A 3: 93,055,765 (GRCm39) Q184K probably damaging Het
Csnka2ip A T 16: 64,298,422 (GRCm39) Y647* probably null Het
D5Ertd579e C T 5: 36,761,874 (GRCm39) R1331H probably benign Het
Dennd5a C T 7: 109,516,587 (GRCm39) probably null Het
Dync1h1 A G 12: 110,593,426 (GRCm39) Q1231R possibly damaging Het
Erbin T A 13: 103,970,239 (GRCm39) I1126F possibly damaging Het
Fastkd1 T C 2: 69,532,813 (GRCm39) D518G probably benign Het
Gcc1 A G 6: 28,421,110 (GRCm39) L69P possibly damaging Het
Gkn1 T C 6: 87,324,151 (GRCm39) Y119C probably damaging Het
Gmpr T G 13: 45,670,520 (GRCm39) W81G probably benign Het
Gyg1 T A 3: 20,192,215 (GRCm39) I236F probably benign Het
Hcrtr2 T C 9: 76,153,735 (GRCm39) Y219C probably damaging Het
Hmcn1 G A 1: 150,441,120 (GRCm39) Q5379* probably null Het
Kank1 T C 19: 25,388,681 (GRCm39) C785R probably benign Het
Lrp1b A T 2: 40,741,818 (GRCm39) C3036* probably null Het
Mdga2 T C 12: 66,736,109 (GRCm39) D373G probably damaging Het
Mgat2 A T 12: 69,232,493 (GRCm39) I356F probably benign Het
Miga2 A G 2: 30,268,009 (GRCm39) D346G probably damaging Het
Mroh2b G A 15: 4,943,622 (GRCm39) R386Q probably benign Het
Mst1r T A 9: 107,797,179 (GRCm39) S1349R probably benign Het
Mtmr3 C T 11: 4,442,825 (GRCm39) R403H possibly damaging Het
Mycbpap G A 11: 94,398,969 (GRCm39) Q460* probably null Het
Myo9a T C 9: 59,775,464 (GRCm39) V1025A probably benign Het
Ncapd2 C T 6: 125,145,553 (GRCm39) E1365K probably null Het
Nkiras2 C A 11: 100,515,989 (GRCm39) D105E probably damaging Het
Nolc1 T G 19: 46,069,870 (GRCm39) probably null Het
Nos1 T C 5: 118,005,297 (GRCm39) F6L probably benign Het
Or10j3 A T 1: 173,030,938 (GRCm39) N5I probably damaging Het
Or12e1 G T 2: 87,022,081 (GRCm39) V17L probably benign Het
Or2t46 T C 11: 58,472,077 (GRCm39) Y136H probably damaging Het
Or2w1b C T 13: 21,300,735 (GRCm39) T291I probably benign Het
Or4f54 T A 2: 111,122,905 (GRCm39) C97* probably null Het
Or8b46 T A 9: 38,450,552 (GRCm39) Y120* probably null Het
Pfkm A G 15: 98,026,199 (GRCm39) E598G possibly damaging Het
Phf2 A T 13: 48,961,106 (GRCm39) D861E unknown Het
Polr2a A G 11: 69,630,703 (GRCm39) probably null Het
Popdc2 G A 16: 38,189,853 (GRCm39) V167M probably damaging Het
Ptpn22 T C 3: 103,793,114 (GRCm39) S422P probably benign Het
Rasa2 T C 9: 96,450,428 (GRCm39) K490R possibly damaging Het
Rbfox3 T A 11: 118,386,047 (GRCm39) D286V probably damaging Het
Rdh13 A G 7: 4,430,790 (GRCm39) W223R probably damaging Het
Riok3 T C 18: 12,261,986 (GRCm39) S7P probably benign Het
Rnaseh2b A G 14: 62,591,081 (GRCm39) E144G probably benign Het
Rnf20 C T 4: 49,651,498 (GRCm39) Q655* probably null Het
Rpap2 T C 5: 107,751,416 (GRCm39) Y8H probably damaging Het
Slc5a10 T C 11: 61,600,428 (GRCm39) Y181C probably benign Het
Snd1 G T 6: 28,888,252 (GRCm39) G896* probably null Het
Spast C T 17: 74,663,155 (GRCm39) Q158* probably null Het
Tas2r104 G A 6: 131,662,547 (GRCm39) S54F probably damaging Het
Tcaf2 C T 6: 42,604,951 (GRCm39) W611* probably null Het
Thoc2l C T 5: 104,668,376 (GRCm39) A966V probably benign Het
Timp4 G A 6: 115,227,364 (GRCm39) probably null Het
Tmem45a G A 16: 56,643,933 (GRCm39) S72L probably benign Het
Tnrc18 T C 5: 142,774,458 (GRCm39) T124A possibly damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Ttn T C 2: 76,773,259 (GRCm39) D2381G probably damaging Het
Uevld T C 7: 46,605,372 (GRCm39) T41A possibly damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Unc5d T C 8: 29,186,506 (GRCm39) E527G probably damaging Het
Vmn2r125 C T 4: 156,703,333 (GRCm39) T237I probably benign Het
Vmn2r63 A C 7: 42,583,038 (GRCm39) I59S probably benign Het
Vps72 G A 3: 95,026,006 (GRCm39) S106N probably benign Het
Zan A C 5: 137,407,931 (GRCm39) probably benign Het
Zbtb38 T C 9: 96,567,515 (GRCm39) K1190E probably benign Het
Zc3h6 T C 2: 128,859,278 (GRCm39) V1103A probably benign Het
Zfp407 G A 18: 84,580,282 (GRCm39) T277I probably damaging Het
Zfp804b A G 5: 6,819,509 (GRCm39) S1149P probably damaging Het
Other mutations in Mprip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Mprip APN 11 59,639,417 (GRCm39) missense probably benign 0.07
IGL00563:Mprip APN 11 59,643,443 (GRCm39) missense probably damaging 1.00
IGL00905:Mprip APN 11 59,662,994 (GRCm39) missense possibly damaging 0.79
IGL00928:Mprip APN 11 59,635,578 (GRCm39) missense probably damaging 1.00
IGL01161:Mprip APN 11 59,622,399 (GRCm39) missense possibly damaging 0.93
IGL01991:Mprip APN 11 59,645,838 (GRCm39) missense probably damaging 0.99
IGL02491:Mprip APN 11 59,660,857 (GRCm39) missense probably benign 0.13
IGL03030:Mprip APN 11 59,631,941 (GRCm39) splice site probably null
IGL03056:Mprip APN 11 59,662,518 (GRCm39) missense probably damaging 1.00
IGL03293:Mprip APN 11 59,586,989 (GRCm39) missense probably damaging 1.00
R0049:Mprip UTSW 11 59,657,571 (GRCm39) missense probably damaging 0.99
R0097:Mprip UTSW 11 59,649,317 (GRCm39) missense possibly damaging 0.90
R0097:Mprip UTSW 11 59,649,317 (GRCm39) missense possibly damaging 0.90
R0147:Mprip UTSW 11 59,627,899 (GRCm39) missense possibly damaging 0.68
R0319:Mprip UTSW 11 59,587,864 (GRCm39) splice site probably benign
R0471:Mprip UTSW 11 59,650,561 (GRCm39) missense probably damaging 1.00
R0539:Mprip UTSW 11 59,631,943 (GRCm39) splice site probably benign
R0627:Mprip UTSW 11 59,660,798 (GRCm39) missense probably damaging 1.00
R0864:Mprip UTSW 11 59,649,587 (GRCm39) missense probably benign
R1218:Mprip UTSW 11 59,634,640 (GRCm39) missense probably damaging 1.00
R1469:Mprip UTSW 11 59,650,016 (GRCm39) missense probably damaging 1.00
R1469:Mprip UTSW 11 59,650,016 (GRCm39) missense probably damaging 1.00
R1695:Mprip UTSW 11 59,643,357 (GRCm39) missense probably damaging 0.99
R1802:Mprip UTSW 11 59,645,867 (GRCm39) missense probably damaging 1.00
R1837:Mprip UTSW 11 59,657,571 (GRCm39) missense probably damaging 0.99
R1862:Mprip UTSW 11 59,649,047 (GRCm39) missense possibly damaging 0.90
R2094:Mprip UTSW 11 59,640,334 (GRCm39) splice site probably benign
R2107:Mprip UTSW 11 59,660,717 (GRCm39) missense probably damaging 1.00
R2108:Mprip UTSW 11 59,660,717 (GRCm39) missense probably damaging 1.00
R2510:Mprip UTSW 11 59,640,334 (GRCm39) splice site probably benign
R3003:Mprip UTSW 11 59,618,381 (GRCm39) missense possibly damaging 0.95
R3115:Mprip UTSW 11 59,656,229 (GRCm39) splice site probably null
R3941:Mprip UTSW 11 59,622,328 (GRCm39) splice site probably benign
R4347:Mprip UTSW 11 59,650,279 (GRCm39) missense possibly damaging 0.86
R4603:Mprip UTSW 11 59,622,399 (GRCm39) missense probably damaging 1.00
R4807:Mprip UTSW 11 59,648,846 (GRCm39) missense probably benign 0.00
R5011:Mprip UTSW 11 59,650,721 (GRCm39) missense possibly damaging 0.75
R5338:Mprip UTSW 11 59,651,399 (GRCm39) missense probably damaging 1.00
R5549:Mprip UTSW 11 59,651,644 (GRCm39) missense probably benign 0.00
R5569:Mprip UTSW 11 59,651,789 (GRCm39) missense probably damaging 1.00
R5604:Mprip UTSW 11 59,649,293 (GRCm39) missense probably benign
R5615:Mprip UTSW 11 59,649,313 (GRCm39) missense probably benign 0.08
R5846:Mprip UTSW 11 59,649,380 (GRCm39) missense probably damaging 1.00
R5970:Mprip UTSW 11 59,648,547 (GRCm39) missense probably damaging 0.96
R6054:Mprip UTSW 11 59,649,251 (GRCm39) missense probably benign
R6452:Mprip UTSW 11 59,643,609 (GRCm39) missense probably damaging 1.00
R6457:Mprip UTSW 11 59,649,815 (GRCm39) missense possibly damaging 0.69
R6544:Mprip UTSW 11 59,648,552 (GRCm39) missense probably benign 0.15
R6750:Mprip UTSW 11 59,586,957 (GRCm39) missense probably damaging 1.00
R6843:Mprip UTSW 11 59,650,554 (GRCm39) missense possibly damaging 0.54
R6851:Mprip UTSW 11 59,649,841 (GRCm39) missense probably damaging 0.99
R6867:Mprip UTSW 11 59,640,456 (GRCm39) critical splice donor site probably null
R7002:Mprip UTSW 11 59,652,016 (GRCm39) missense probably benign 0.22
R7023:Mprip UTSW 11 59,628,215 (GRCm39) missense probably damaging 1.00
R7764:Mprip UTSW 11 59,655,242 (GRCm39) missense probably damaging 0.99
R7765:Mprip UTSW 11 59,649,047 (GRCm39) missense possibly damaging 0.90
R7828:Mprip UTSW 11 59,627,915 (GRCm39) missense probably damaging 1.00
R7866:Mprip UTSW 11 59,643,756 (GRCm39) missense possibly damaging 0.60
R7911:Mprip UTSW 11 59,651,681 (GRCm39) missense
R7979:Mprip UTSW 11 59,657,682 (GRCm39) missense probably damaging 1.00
R8292:Mprip UTSW 11 59,650,340 (GRCm39) missense probably benign 0.21
R8481:Mprip UTSW 11 59,648,982 (GRCm39) nonsense probably null
R8717:Mprip UTSW 11 59,650,526 (GRCm39) missense probably benign
R8810:Mprip UTSW 11 59,587,851 (GRCm39) critical splice donor site probably benign
R8981:Mprip UTSW 11 59,622,383 (GRCm39) missense probably damaging 1.00
R9214:Mprip UTSW 11 59,650,901 (GRCm39) missense possibly damaging 0.69
R9245:Mprip UTSW 11 59,628,403 (GRCm39) missense possibly damaging 0.68
R9748:Mprip UTSW 11 59,656,348 (GRCm39) missense probably damaging 1.00
Z1176:Mprip UTSW 11 59,650,310 (GRCm39) missense probably benign 0.05
Z1176:Mprip UTSW 11 59,628,230 (GRCm39) missense possibly damaging 0.83
Z1177:Mprip UTSW 11 59,648,463 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGAGCATACAGGAGACCCTAC -3'
(R):5'- TATGAGAGATGCTGGGACATCCGC -3'

Sequencing Primer
(F):5'- CTACAAGGGACCCAGGCAG -3'
(R):5'- GCAGAAGCCTCTGGCAAC -3'
Posted On 2014-05-14