Incidental Mutation 'R1698:Mprip'
ID192429
Institutional Source Beutler Lab
Gene Symbol Mprip
Ensembl Gene ENSMUSG00000005417
Gene Namemyosin phosphatase Rho interacting protein
Synonymsp116Rip, Rhoip3, RIP3, p116 Rho interacting protein
MMRRC Submission 039731-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.516) question?
Stock #R1698 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location59661305-59780860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59760258 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1596 (L1596Q)
Ref Sequence ENSEMBL: ENSMUSP00000071081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066330] [ENSMUST00000072031] [ENSMUST00000108751] [ENSMUST00000116371] [ENSMUST00000133861]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066330
AA Change: L1596Q

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000071081
Gene: ENSMUSG00000005417
AA Change: L1596Q

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 249 320 1e-10 BLAST
PH 351 448 3.76e-18 SMART
low complexity region 492 501 N/A INTRINSIC
low complexity region 536 555 N/A INTRINSIC
coiled coil region 636 671 N/A INTRINSIC
Blast:PAC 806 848 2e-10 BLAST
low complexity region 1005 1023 N/A INTRINSIC
low complexity region 1047 1059 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1183 1200 N/A INTRINSIC
coiled coil region 1267 1300 N/A INTRINSIC
coiled coil region 1617 1642 N/A INTRINSIC
coiled coil region 1729 1779 N/A INTRINSIC
coiled coil region 1899 1936 N/A INTRINSIC
coiled coil region 1960 2110 N/A INTRINSIC
coiled coil region 2132 2206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072031
SMART Domains Protein: ENSMUSP00000071914
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 254 320 1e-10 BLAST
PH 387 484 3.76e-18 SMART
low complexity region 528 537 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
coiled coil region 672 707 N/A INTRINSIC
coiled coil region 728 878 N/A INTRINSIC
coiled coil region 900 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108751
SMART Domains Protein: ENSMUSP00000104382
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 183 196 N/A INTRINSIC
Blast:PH 216 282 1e-10 BLAST
PH 349 446 3.76e-18 SMART
low complexity region 490 499 N/A INTRINSIC
low complexity region 534 553 N/A INTRINSIC
coiled coil region 634 669 N/A INTRINSIC
coiled coil region 690 840 N/A INTRINSIC
coiled coil region 862 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116371
SMART Domains Protein: ENSMUSP00000112072
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 254 320 1e-10 BLAST
PH 387 484 3.76e-18 SMART
low complexity region 528 537 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
coiled coil region 672 707 N/A INTRINSIC
coiled coil region 728 878 N/A INTRINSIC
coiled coil region 900 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132620
SMART Domains Protein: ENSMUSP00000119422
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
Blast:PH 101 167 9e-11 BLAST
PH 198 295 3.76e-18 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 383 402 N/A INTRINSIC
coiled coil region 482 517 N/A INTRINSIC
coiled coil region 538 688 N/A INTRINSIC
coiled coil region 710 784 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133861
SMART Domains Protein: ENSMUSP00000119562
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
low complexity region 89 102 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
PH 373 470 3.76e-18 SMART
low complexity region 514 523 N/A INTRINSIC
low complexity region 558 577 N/A INTRINSIC
coiled coil region 658 693 N/A INTRINSIC
coiled coil region 714 864 N/A INTRINSIC
coiled coil region 886 960 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156111
SMART Domains Protein: ENSMUSP00000114446
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
internal_repeat_1 5 38 1.61e-7 PROSPERO
internal_repeat_2 9 51 2.4e-6 PROSPERO
internal_repeat_1 59 92 1.61e-7 PROSPERO
internal_repeat_2 85 129 2.4e-6 PROSPERO
coiled coil region 140 177 N/A INTRINSIC
coiled coil region 201 351 N/A INTRINSIC
coiled coil region 373 447 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,645,158 E340A possibly damaging Het
Abca13 A G 11: 9,314,507 D2963G probably benign Het
Actn3 T C 19: 4,862,207 D783G possibly damaging Het
Adamtsl2 A G 2: 27,103,127 E723G possibly damaging Het
Agrn G T 4: 156,166,558 Q1931K probably benign Het
Ankrd27 G A 7: 35,614,521 A426T probably benign Het
Atg9b C A 5: 24,388,188 G406C probably damaging Het
BC005561 C T 5: 104,520,510 A966V probably benign Het
C1ra A T 6: 124,522,766 Q637L probably benign Het
Cdhr2 A T 13: 54,719,581 M438L probably benign Het
Cep350 T C 1: 155,953,358 I267V possibly damaging Het
Chrna5 A G 9: 55,004,642 Y138C probably damaging Het
Chst3 T A 10: 60,185,703 M441L probably benign Het
Cmya5 G A 13: 93,063,519 P3434S probably benign Het
Cog2 T A 8: 124,525,683 L42Q probably damaging Het
Cpq A T 15: 33,250,126 I210F probably benign Het
Crnn C A 3: 93,148,458 Q184K probably damaging Het
Csnka2ip A T 16: 64,478,059 Y647* probably null Het
D5Ertd579e C T 5: 36,604,530 R1331H probably benign Het
Dennd5a C T 7: 109,917,380 probably null Het
Dync1h1 A G 12: 110,626,992 Q1231R possibly damaging Het
Erbin T A 13: 103,833,731 I1126F possibly damaging Het
Fastkd1 T C 2: 69,702,469 D518G probably benign Het
Gcc1 A G 6: 28,421,111 L69P possibly damaging Het
Gkn1 T C 6: 87,347,169 Y119C probably damaging Het
Gmpr T G 13: 45,517,044 W81G probably benign Het
Gyg T A 3: 20,138,051 I236F probably benign Het
Hcrtr2 T C 9: 76,246,453 Y219C probably damaging Het
Hmcn1 G A 1: 150,565,369 Q5379* probably null Het
Kank1 T C 19: 25,411,317 C785R probably benign Het
Lrp1b A T 2: 40,851,806 C3036* probably null Het
Mdga2 T C 12: 66,689,335 D373G probably damaging Het
Mgat2 A T 12: 69,185,719 I356F probably benign Het
Miga2 A G 2: 30,377,997 D346G probably damaging Het
Mroh2b G A 15: 4,914,140 R386Q probably benign Het
Mst1r T A 9: 107,919,980 S1349R probably benign Het
Mtmr3 C T 11: 4,492,825 R403H possibly damaging Het
Mycbpap G A 11: 94,508,143 Q460* probably null Het
Myo9a T C 9: 59,868,181 V1025A probably benign Het
Ncapd2 C T 6: 125,168,590 E1365K probably null Het
Nkiras2 C A 11: 100,625,163 D105E probably damaging Het
Nolc1 T G 19: 46,081,431 probably null Het
Nos1 T C 5: 117,867,232 F6L probably benign Het
Olfr1112 G T 2: 87,191,737 V17L probably benign Het
Olfr1278 T A 2: 111,292,560 C97* probably null Het
Olfr1369-ps1 C T 13: 21,116,565 T291I probably benign Het
Olfr218 A T 1: 173,203,371 N5I probably damaging Het
Olfr325 T C 11: 58,581,251 Y136H probably damaging Het
Olfr910 T A 9: 38,539,256 Y120* probably null Het
Pfkm A G 15: 98,128,318 E598G possibly damaging Het
Phf2 A T 13: 48,807,630 D861E unknown Het
Polr2a A G 11: 69,739,877 probably null Het
Popdc2 G A 16: 38,369,491 V167M probably damaging Het
Ptpn22 T C 3: 103,885,798 S422P probably benign Het
Rasa2 T C 9: 96,568,375 K490R possibly damaging Het
Rbfox3 T A 11: 118,495,221 D286V probably damaging Het
Rdh13 A G 7: 4,427,791 W223R probably damaging Het
Riok3 T C 18: 12,128,929 S7P probably benign Het
Rnaseh2b A G 14: 62,353,632 E144G probably benign Het
Rnf20 C T 4: 49,651,498 Q655* probably null Het
Rpap2 T C 5: 107,603,550 Y8H probably damaging Het
Slc5a10 T C 11: 61,709,602 Y181C probably benign Het
Snd1 G T 6: 28,888,253 G896* probably null Het
Spast C T 17: 74,356,160 Q158* probably null Het
Tas2r104 G A 6: 131,685,584 S54F probably damaging Het
Tcaf2 C T 6: 42,628,017 W611* probably null Het
Timp4 G A 6: 115,250,403 probably null Het
Tmem45a G A 16: 56,823,570 S72L probably benign Het
Tnrc18 T C 5: 142,788,703 T124A possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttn T C 2: 76,942,915 D2381G probably damaging Het
Uevld T C 7: 46,955,624 T41A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc5d T C 8: 28,696,478 E527G probably damaging Het
Vmn2r125 C T 4: 156,351,038 T237I probably benign Het
Vmn2r63 A C 7: 42,933,614 I59S probably benign Het
Vps72 G A 3: 95,118,695 S106N probably benign Het
Zan A C 5: 137,409,669 probably benign Het
Zbtb38 T C 9: 96,685,462 K1190E probably benign Het
Zc3h6 T C 2: 129,017,358 V1103A probably benign Het
Zfp407 G A 18: 84,562,157 T277I probably damaging Het
Zfp804b A G 5: 6,769,509 S1149P probably damaging Het
Other mutations in Mprip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Mprip APN 11 59748591 missense probably benign 0.07
IGL00563:Mprip APN 11 59752617 missense probably damaging 1.00
IGL00905:Mprip APN 11 59772168 missense possibly damaging 0.79
IGL00928:Mprip APN 11 59744752 missense probably damaging 1.00
IGL01161:Mprip APN 11 59731573 missense possibly damaging 0.93
IGL01991:Mprip APN 11 59755012 missense probably damaging 0.99
IGL02491:Mprip APN 11 59770031 missense probably benign 0.13
IGL03030:Mprip APN 11 59741115 splice site probably null
IGL03056:Mprip APN 11 59771692 missense probably damaging 1.00
IGL03293:Mprip APN 11 59696163 missense probably damaging 1.00
R0049:Mprip UTSW 11 59766745 missense probably damaging 0.99
R0097:Mprip UTSW 11 59758491 missense possibly damaging 0.90
R0097:Mprip UTSW 11 59758491 missense possibly damaging 0.90
R0147:Mprip UTSW 11 59737073 missense possibly damaging 0.68
R0319:Mprip UTSW 11 59697038 splice site probably benign
R0471:Mprip UTSW 11 59759735 missense probably damaging 1.00
R0539:Mprip UTSW 11 59741117 splice site probably benign
R0627:Mprip UTSW 11 59769972 missense probably damaging 1.00
R0864:Mprip UTSW 11 59758761 missense probably benign
R1218:Mprip UTSW 11 59743814 missense probably damaging 1.00
R1469:Mprip UTSW 11 59759190 missense probably damaging 1.00
R1469:Mprip UTSW 11 59759190 missense probably damaging 1.00
R1695:Mprip UTSW 11 59752531 missense probably damaging 0.99
R1802:Mprip UTSW 11 59755041 missense probably damaging 1.00
R1837:Mprip UTSW 11 59766745 missense probably damaging 0.99
R1862:Mprip UTSW 11 59758221 missense possibly damaging 0.90
R2094:Mprip UTSW 11 59749508 splice site probably benign
R2107:Mprip UTSW 11 59769891 missense probably damaging 1.00
R2108:Mprip UTSW 11 59769891 missense probably damaging 1.00
R2510:Mprip UTSW 11 59749508 splice site probably benign
R3003:Mprip UTSW 11 59727555 missense possibly damaging 0.95
R3115:Mprip UTSW 11 59765403 splice site probably null
R3941:Mprip UTSW 11 59731502 splice site probably benign
R4347:Mprip UTSW 11 59759453 missense possibly damaging 0.86
R4603:Mprip UTSW 11 59731573 missense probably damaging 1.00
R4807:Mprip UTSW 11 59758020 missense probably benign 0.00
R5011:Mprip UTSW 11 59759895 missense possibly damaging 0.75
R5338:Mprip UTSW 11 59760573 missense probably damaging 1.00
R5549:Mprip UTSW 11 59760818 missense probably benign 0.00
R5569:Mprip UTSW 11 59760963 missense probably damaging 1.00
R5604:Mprip UTSW 11 59758467 missense probably benign
R5615:Mprip UTSW 11 59758487 missense probably benign 0.08
R5846:Mprip UTSW 11 59758554 missense probably damaging 1.00
R5970:Mprip UTSW 11 59757721 missense probably damaging 0.96
R6054:Mprip UTSW 11 59758425 missense probably benign
R6452:Mprip UTSW 11 59752783 missense probably damaging 1.00
R6457:Mprip UTSW 11 59758989 missense possibly damaging 0.69
R6544:Mprip UTSW 11 59757726 missense probably benign 0.15
R6750:Mprip UTSW 11 59696131 missense probably damaging 1.00
R6843:Mprip UTSW 11 59759728 missense possibly damaging 0.54
R6851:Mprip UTSW 11 59759015 missense probably damaging 0.99
R6867:Mprip UTSW 11 59749630 critical splice donor site probably null
R7002:Mprip UTSW 11 59761190 missense probably benign 0.22
R7023:Mprip UTSW 11 59737389 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGAGCATACAGGAGACCCTAC -3'
(R):5'- TATGAGAGATGCTGGGACATCCGC -3'

Sequencing Primer
(F):5'- CTACAAGGGACCCAGGCAG -3'
(R):5'- GCAGAAGCCTCTGGCAAC -3'
Posted On2014-05-14