Incidental Mutation 'R1698:Slc5a10'
ID192430
Institutional Source Beutler Lab
Gene Symbol Slc5a10
Ensembl Gene ENSMUSG00000042371
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 10
SynonymsC330021F16Rik, SGLT5
MMRRC Submission 039731-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R1698 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location61672781-61720826 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61709602 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 181 (Y181C)
Ref Sequence ENSEMBL: ENSMUSP00000118196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051552] [ENSMUST00000093019] [ENSMUST00000148584] [ENSMUST00000151780]
Predicted Effect probably benign
Transcript: ENSMUST00000051552
AA Change: Y183C

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000054407
Gene: ENSMUSG00000042371
AA Change: Y183C

DomainStartEndE-ValueType
Pfam:SSF 50 479 2.4e-139 PFAM
transmembrane domain 513 535 N/A INTRINSIC
transmembrane domain 576 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093019
SMART Domains Protein: ENSMUSP00000090697
Gene: ENSMUSG00000042377

DomainStartEndE-ValueType
Pfam:DUF1669 15 309 1.8e-120 PFAM
Pfam:PLDc_2 165 304 5.5e-11 PFAM
low complexity region 316 336 N/A INTRINSIC
low complexity region 468 481 N/A INTRINSIC
low complexity region 577 585 N/A INTRINSIC
low complexity region 589 604 N/A INTRINSIC
low complexity region 721 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128196
Predicted Effect probably benign
Transcript: ENSMUST00000148584
AA Change: Y183C

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114523
Gene: ENSMUSG00000042371
AA Change: Y183C

DomainStartEndE-ValueType
Pfam:SSF 50 479 2.4e-139 PFAM
transmembrane domain 513 535 N/A INTRINSIC
transmembrane domain 576 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151780
AA Change: Y181C

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118196
Gene: ENSMUSG00000042371
AA Change: Y181C

DomainStartEndE-ValueType
Pfam:SSF 48 185 3.5e-44 PFAM
Pfam:SSF 182 450 5e-79 PFAM
transmembrane domain 484 506 N/A INTRINSIC
transmembrane domain 547 566 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the sodium/glucose transporter family. Members of this family are sodium-dependent transporters and can be divided into two subfamilies based on sequence homology, one that co-transports sugars and the second that transports molecules such as ascorbate, choline, iodide, lipoate, monocaroboxylates, and pantothenate. The protein encoded by this gene has the highest affinity for mannose and has been reported to be most highly expressed in the kidney. This protein may function as a kidney-specific, sodium-dependent mannose and fructose co-transporter. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired fructose reabsorption in the kidneys and exacerbated hepatic steatosis induced by fructose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,645,158 E340A possibly damaging Het
Abca13 A G 11: 9,314,507 D2963G probably benign Het
Actn3 T C 19: 4,862,207 D783G possibly damaging Het
Adamtsl2 A G 2: 27,103,127 E723G possibly damaging Het
Agrn G T 4: 156,166,558 Q1931K probably benign Het
Ankrd27 G A 7: 35,614,521 A426T probably benign Het
Atg9b C A 5: 24,388,188 G406C probably damaging Het
BC005561 C T 5: 104,520,510 A966V probably benign Het
C1ra A T 6: 124,522,766 Q637L probably benign Het
Cdhr2 A T 13: 54,719,581 M438L probably benign Het
Cep350 T C 1: 155,953,358 I267V possibly damaging Het
Chrna5 A G 9: 55,004,642 Y138C probably damaging Het
Chst3 T A 10: 60,185,703 M441L probably benign Het
Cmya5 G A 13: 93,063,519 P3434S probably benign Het
Cog2 T A 8: 124,525,683 L42Q probably damaging Het
Cpq A T 15: 33,250,126 I210F probably benign Het
Crnn C A 3: 93,148,458 Q184K probably damaging Het
Csnka2ip A T 16: 64,478,059 Y647* probably null Het
D5Ertd579e C T 5: 36,604,530 R1331H probably benign Het
Dennd5a C T 7: 109,917,380 probably null Het
Dync1h1 A G 12: 110,626,992 Q1231R possibly damaging Het
Erbin T A 13: 103,833,731 I1126F possibly damaging Het
Fastkd1 T C 2: 69,702,469 D518G probably benign Het
Gcc1 A G 6: 28,421,111 L69P possibly damaging Het
Gkn1 T C 6: 87,347,169 Y119C probably damaging Het
Gmpr T G 13: 45,517,044 W81G probably benign Het
Gyg T A 3: 20,138,051 I236F probably benign Het
Hcrtr2 T C 9: 76,246,453 Y219C probably damaging Het
Hmcn1 G A 1: 150,565,369 Q5379* probably null Het
Kank1 T C 19: 25,411,317 C785R probably benign Het
Lrp1b A T 2: 40,851,806 C3036* probably null Het
Mdga2 T C 12: 66,689,335 D373G probably damaging Het
Mgat2 A T 12: 69,185,719 I356F probably benign Het
Miga2 A G 2: 30,377,997 D346G probably damaging Het
Mprip T A 11: 59,760,258 L1596Q possibly damaging Het
Mroh2b G A 15: 4,914,140 R386Q probably benign Het
Mst1r T A 9: 107,919,980 S1349R probably benign Het
Mtmr3 C T 11: 4,492,825 R403H possibly damaging Het
Mycbpap G A 11: 94,508,143 Q460* probably null Het
Myo9a T C 9: 59,868,181 V1025A probably benign Het
Ncapd2 C T 6: 125,168,590 E1365K probably null Het
Nkiras2 C A 11: 100,625,163 D105E probably damaging Het
Nolc1 T G 19: 46,081,431 probably null Het
Nos1 T C 5: 117,867,232 F6L probably benign Het
Olfr1112 G T 2: 87,191,737 V17L probably benign Het
Olfr1278 T A 2: 111,292,560 C97* probably null Het
Olfr1369-ps1 C T 13: 21,116,565 T291I probably benign Het
Olfr218 A T 1: 173,203,371 N5I probably damaging Het
Olfr325 T C 11: 58,581,251 Y136H probably damaging Het
Olfr910 T A 9: 38,539,256 Y120* probably null Het
Pfkm A G 15: 98,128,318 E598G possibly damaging Het
Phf2 A T 13: 48,807,630 D861E unknown Het
Polr2a A G 11: 69,739,877 probably null Het
Popdc2 G A 16: 38,369,491 V167M probably damaging Het
Ptpn22 T C 3: 103,885,798 S422P probably benign Het
Rasa2 T C 9: 96,568,375 K490R possibly damaging Het
Rbfox3 T A 11: 118,495,221 D286V probably damaging Het
Rdh13 A G 7: 4,427,791 W223R probably damaging Het
Riok3 T C 18: 12,128,929 S7P probably benign Het
Rnaseh2b A G 14: 62,353,632 E144G probably benign Het
Rnf20 C T 4: 49,651,498 Q655* probably null Het
Rpap2 T C 5: 107,603,550 Y8H probably damaging Het
Snd1 G T 6: 28,888,253 G896* probably null Het
Spast C T 17: 74,356,160 Q158* probably null Het
Tas2r104 G A 6: 131,685,584 S54F probably damaging Het
Tcaf2 C T 6: 42,628,017 W611* probably null Het
Timp4 G A 6: 115,250,403 probably null Het
Tmem45a G A 16: 56,823,570 S72L probably benign Het
Tnrc18 T C 5: 142,788,703 T124A possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttn T C 2: 76,942,915 D2381G probably damaging Het
Uevld T C 7: 46,955,624 T41A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc5d T C 8: 28,696,478 E527G probably damaging Het
Vmn2r125 C T 4: 156,351,038 T237I probably benign Het
Vmn2r63 A C 7: 42,933,614 I59S probably benign Het
Vps72 G A 3: 95,118,695 S106N probably benign Het
Zan A C 5: 137,409,669 probably benign Het
Zbtb38 T C 9: 96,685,462 K1190E probably benign Het
Zc3h6 T C 2: 129,017,358 V1103A probably benign Het
Zfp407 G A 18: 84,562,157 T277I probably damaging Het
Zfp804b A G 5: 6,769,509 S1149P probably damaging Het
Other mutations in Slc5a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Slc5a10 APN 11 61715136 missense probably damaging 0.99
IGL02215:Slc5a10 APN 11 61673912 missense probably benign 0.00
IGL02354:Slc5a10 APN 11 61719840 critical splice donor site probably null
IGL02361:Slc5a10 APN 11 61719840 critical splice donor site probably null
IGL02573:Slc5a10 APN 11 61673072 missense possibly damaging 0.89
IGL02712:Slc5a10 APN 11 61707806 nonsense probably null
R1535:Slc5a10 UTSW 11 61673941 missense possibly damaging 0.65
R1659:Slc5a10 UTSW 11 61676244 missense possibly damaging 0.94
R2161:Slc5a10 UTSW 11 61719934 missense probably null 0.17
R4948:Slc5a10 UTSW 11 61719882 missense probably damaging 0.98
R5686:Slc5a10 UTSW 11 61678566 missense probably benign 0.19
R5689:Slc5a10 UTSW 11 61707884 missense probably benign 0.16
R7398:Slc5a10 UTSW 11 61673579 missense probably benign
R7769:Slc5a10 UTSW 11 61673647 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGACTGCCAAAATGACAGCACC -3'
(R):5'- GCCCTGAATCTCACCGTAATGTCTG -3'

Sequencing Primer
(F):5'- GCAGGGCATCTGTGTATATCAC -3'
(R):5'- GAATCTCACCGTAATGTCTGACTTC -3'
Posted On2014-05-14