Incidental Mutation 'R1698:Mroh2b'
ID192447
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Namemaestro heat-like repeat family member 2B
Synonyms4930455B06Rik, Heatr7b2
MMRRC Submission 039731-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R1698 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location4898737-4962205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4914140 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 386 (R386Q)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
Predicted Effect probably benign
Transcript: ENSMUST00000045736
AA Change: R386Q

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: R386Q

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,645,158 E340A possibly damaging Het
Abca13 A G 11: 9,314,507 D2963G probably benign Het
Actn3 T C 19: 4,862,207 D783G possibly damaging Het
Adamtsl2 A G 2: 27,103,127 E723G possibly damaging Het
Agrn G T 4: 156,166,558 Q1931K probably benign Het
Ankrd27 G A 7: 35,614,521 A426T probably benign Het
Atg9b C A 5: 24,388,188 G406C probably damaging Het
BC005561 C T 5: 104,520,510 A966V probably benign Het
C1ra A T 6: 124,522,766 Q637L probably benign Het
Cdhr2 A T 13: 54,719,581 M438L probably benign Het
Cep350 T C 1: 155,953,358 I267V possibly damaging Het
Chrna5 A G 9: 55,004,642 Y138C probably damaging Het
Chst3 T A 10: 60,185,703 M441L probably benign Het
Cmya5 G A 13: 93,063,519 P3434S probably benign Het
Cog2 T A 8: 124,525,683 L42Q probably damaging Het
Cpq A T 15: 33,250,126 I210F probably benign Het
Crnn C A 3: 93,148,458 Q184K probably damaging Het
Csnka2ip A T 16: 64,478,059 Y647* probably null Het
D5Ertd579e C T 5: 36,604,530 R1331H probably benign Het
Dennd5a C T 7: 109,917,380 probably null Het
Dync1h1 A G 12: 110,626,992 Q1231R possibly damaging Het
Erbin T A 13: 103,833,731 I1126F possibly damaging Het
Fastkd1 T C 2: 69,702,469 D518G probably benign Het
Gcc1 A G 6: 28,421,111 L69P possibly damaging Het
Gkn1 T C 6: 87,347,169 Y119C probably damaging Het
Gmpr T G 13: 45,517,044 W81G probably benign Het
Gyg T A 3: 20,138,051 I236F probably benign Het
Hcrtr2 T C 9: 76,246,453 Y219C probably damaging Het
Hmcn1 G A 1: 150,565,369 Q5379* probably null Het
Kank1 T C 19: 25,411,317 C785R probably benign Het
Lrp1b A T 2: 40,851,806 C3036* probably null Het
Mdga2 T C 12: 66,689,335 D373G probably damaging Het
Mgat2 A T 12: 69,185,719 I356F probably benign Het
Miga2 A G 2: 30,377,997 D346G probably damaging Het
Mprip T A 11: 59,760,258 L1596Q possibly damaging Het
Mst1r T A 9: 107,919,980 S1349R probably benign Het
Mtmr3 C T 11: 4,492,825 R403H possibly damaging Het
Mycbpap G A 11: 94,508,143 Q460* probably null Het
Myo9a T C 9: 59,868,181 V1025A probably benign Het
Ncapd2 C T 6: 125,168,590 E1365K probably null Het
Nkiras2 C A 11: 100,625,163 D105E probably damaging Het
Nolc1 T G 19: 46,081,431 probably null Het
Nos1 T C 5: 117,867,232 F6L probably benign Het
Olfr1112 G T 2: 87,191,737 V17L probably benign Het
Olfr1278 T A 2: 111,292,560 C97* probably null Het
Olfr1369-ps1 C T 13: 21,116,565 T291I probably benign Het
Olfr218 A T 1: 173,203,371 N5I probably damaging Het
Olfr325 T C 11: 58,581,251 Y136H probably damaging Het
Olfr910 T A 9: 38,539,256 Y120* probably null Het
Pfkm A G 15: 98,128,318 E598G possibly damaging Het
Phf2 A T 13: 48,807,630 D861E unknown Het
Polr2a A G 11: 69,739,877 probably null Het
Popdc2 G A 16: 38,369,491 V167M probably damaging Het
Ptpn22 T C 3: 103,885,798 S422P probably benign Het
Rasa2 T C 9: 96,568,375 K490R possibly damaging Het
Rbfox3 T A 11: 118,495,221 D286V probably damaging Het
Rdh13 A G 7: 4,427,791 W223R probably damaging Het
Riok3 T C 18: 12,128,929 S7P probably benign Het
Rnaseh2b A G 14: 62,353,632 E144G probably benign Het
Rnf20 C T 4: 49,651,498 Q655* probably null Het
Rpap2 T C 5: 107,603,550 Y8H probably damaging Het
Slc5a10 T C 11: 61,709,602 Y181C probably benign Het
Snd1 G T 6: 28,888,253 G896* probably null Het
Spast C T 17: 74,356,160 Q158* probably null Het
Tas2r104 G A 6: 131,685,584 S54F probably damaging Het
Tcaf2 C T 6: 42,628,017 W611* probably null Het
Timp4 G A 6: 115,250,403 probably null Het
Tmem45a G A 16: 56,823,570 S72L probably benign Het
Tnrc18 T C 5: 142,788,703 T124A possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttn T C 2: 76,942,915 D2381G probably damaging Het
Uevld T C 7: 46,955,624 T41A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc5d T C 8: 28,696,478 E527G probably damaging Het
Vmn2r125 C T 4: 156,351,038 T237I probably benign Het
Vmn2r63 A C 7: 42,933,614 I59S probably benign Het
Vps72 G A 3: 95,118,695 S106N probably benign Het
Zan A C 5: 137,409,669 probably benign Het
Zbtb38 T C 9: 96,685,462 K1190E probably benign Het
Zc3h6 T C 2: 129,017,358 V1103A probably benign Het
Zfp407 G A 18: 84,562,157 T277I probably damaging Het
Zfp804b A G 5: 6,769,509 S1149P probably damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 splice site probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4931061 missense probably benign 0.09
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4917131 missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4949105 missense probably benign 0.36
R7848:Mroh2b UTSW 15 4938379 nonsense probably null
R7952:Mroh2b UTSW 15 4951211 missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4921357 nonsense probably null
R8088:Mroh2b UTSW 15 4900503 missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4938410 missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4909040 missense probably benign 0.04
R8248:Mroh2b UTSW 15 4931104 missense probably benign 0.40
R8258:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8259:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8304:Mroh2b UTSW 15 4925637 missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4951264 nonsense probably null
R8345:Mroh2b UTSW 15 4944326 missense probably benign 0.09
R8507:Mroh2b UTSW 15 4949090 missense probably damaging 1.00
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4905005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCCCACCTCTGGATGTTCCAAAG -3'
(R):5'- TGTTTAGAAGCTGCCCAGCTCAAG -3'

Sequencing Primer
(F):5'- AAGGAAGTCCACCCTTCTTCTC -3'
(R):5'- catttttgcgtttgtggctc -3'
Posted On2014-05-14