Mutagenetix > Incidental Mutation

Incidental Mutation 'R1698:Kank1'

192459

Institutional Source

Beutler Lab

Gene Symbol

Kank1

Ensembl Gene

ENSMUSG00000032702

Gene Name

KN motif and ankyrin repeat domains 1

Synonyms

D330024H06Rik, Ankrd15, A930031B09Rik

MMRRC Submission

039731-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1698 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25236975-25434496 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25411317 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 785 (C785R)

Ref Sequence

ENSEMBL: ENSMUSP00000116660 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049400] [ENSMUST00000146647]

AlphaFold

E9Q238

Predicted Effect

probably benign
Transcript: ENSMUST00000049400
AA Change: C757R

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000042177
Gene: ENSMUSG00000032702
AA Change: C757R

Domain	Start	End	E-Value	Type
Pfam:KN_motif	30	68	3.3e-24	PFAM
low complexity region	88	105	N/A	INTRINSIC
low complexity region	138	148	N/A	INTRINSIC
coiled coil region	286	314	N/A	INTRINSIC
low complexity region	350	358	N/A	INTRINSIC
coiled coil region	362	395	N/A	INTRINSIC
coiled coil region	451	494	N/A	INTRINSIC
low complexity region	541	556	N/A	INTRINSIC
low complexity region	617	629	N/A	INTRINSIC
Blast:ANK	963	993	7e-10	BLAST
low complexity region	1010	1030	N/A	INTRINSIC
low complexity region	1074	1095	N/A	INTRINSIC
ANK	1169	1199	3.71e-4	SMART
ANK	1203	1236	2.27e1	SMART
ANK	1241	1270	1.33e-5	SMART
ANK	1274	1306	5.84e-2	SMART
ANK	1308	1336	4.86e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137260

Predicted Effect

probably benign
Transcript: ENSMUST00000146647
AA Change: C785R

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000116660
Gene: ENSMUSG00000032702
AA Change: C785R

Domain	Start	End	E-Value	Type
Pfam:KN_motif	58	96	2e-25	PFAM
low complexity region	116	133	N/A	INTRINSIC
low complexity region	166	176	N/A	INTRINSIC
coiled coil region	314	342	N/A	INTRINSIC
low complexity region	378	386	N/A	INTRINSIC
coiled coil region	390	423	N/A	INTRINSIC
internal_repeat_1	430	479	3.72e-5	PROSPERO
low complexity region	569	584	N/A	INTRINSIC
internal_repeat_1	587	636	3.72e-5	PROSPERO
low complexity region	645	657	N/A	INTRINSIC
Blast:ANK	991	1021	4e-10	BLAST
low complexity region	1038	1058	N/A	INTRINSIC
low complexity region	1102	1123	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	C	6: 121,645,158	E340A	possibly damaging	Het
Abca13	A	G	11: 9,314,507	D2963G	probably benign	Het
Actn3	T	C	19: 4,862,207	D783G	possibly damaging	Het
Adamtsl2	A	G	2: 27,103,127	E723G	possibly damaging	Het
Agrn	G	T	4: 156,166,558	Q1931K	probably benign	Het
Ankrd27	G	A	7: 35,614,521	A426T	probably benign	Het
Atg9b	C	A	5: 24,388,188	G406C	probably damaging	Het
BC005561	C	T	5: 104,520,510	A966V	probably benign	Het
C1ra	A	T	6: 124,522,766	Q637L	probably benign	Het
Cdhr2	A	T	13: 54,719,581	M438L	probably benign	Het
Cep350	T	C	1: 155,953,358	I267V	possibly damaging	Het
Chrna5	A	G	9: 55,004,642	Y138C	probably damaging	Het
Chst3	T	A	10: 60,185,703	M441L	probably benign	Het
Cmya5	G	A	13: 93,063,519	P3434S	probably benign	Het
Cog2	T	A	8: 124,525,683	L42Q	probably damaging	Het
Cpq	A	T	15: 33,250,126	I210F	probably benign	Het
Crnn	C	A	3: 93,148,458	Q184K	probably damaging	Het
Csnka2ip	A	T	16: 64,478,059	Y647*	probably null	Het
D5Ertd579e	C	T	5: 36,604,530	R1331H	probably benign	Het
Dennd5a	C	T	7: 109,917,380		probably null	Het
Dync1h1	A	G	12: 110,626,992	Q1231R	possibly damaging	Het
Erbin	T	A	13: 103,833,731	I1126F	possibly damaging	Het
Fastkd1	T	C	2: 69,702,469	D518G	probably benign	Het
Gcc1	A	G	6: 28,421,111	L69P	possibly damaging	Het
Gkn1	T	C	6: 87,347,169	Y119C	probably damaging	Het
Gmpr	T	G	13: 45,517,044	W81G	probably benign	Het
Gyg	T	A	3: 20,138,051	I236F	probably benign	Het
Hcrtr2	T	C	9: 76,246,453	Y219C	probably damaging	Het
Hmcn1	G	A	1: 150,565,369	Q5379*	probably null	Het
Lrp1b	A	T	2: 40,851,806	C3036*	probably null	Het
Mdga2	T	C	12: 66,689,335	D373G	probably damaging	Het
Mgat2	A	T	12: 69,185,719	I356F	probably benign	Het
Miga2	A	G	2: 30,377,997	D346G	probably damaging	Het
Mprip	T	A	11: 59,760,258	L1596Q	possibly damaging	Het
Mroh2b	G	A	15: 4,914,140	R386Q	probably benign	Het
Mst1r	T	A	9: 107,919,980	S1349R	probably benign	Het
Mtmr3	C	T	11: 4,492,825	R403H	possibly damaging	Het
Mycbpap	G	A	11: 94,508,143	Q460*	probably null	Het
Myo9a	T	C	9: 59,868,181	V1025A	probably benign	Het
Ncapd2	C	T	6: 125,168,590	E1365K	probably null	Het
Nkiras2	C	A	11: 100,625,163	D105E	probably damaging	Het
Nolc1	T	G	19: 46,081,431		probably null	Het
Nos1	T	C	5: 117,867,232	F6L	probably benign	Het
Olfr1112	G	T	2: 87,191,737	V17L	probably benign	Het
Olfr1278	T	A	2: 111,292,560	C97*	probably null	Het
Olfr1369-ps1	C	T	13: 21,116,565	T291I	probably benign	Het
Olfr218	A	T	1: 173,203,371	N5I	probably damaging	Het
Olfr325	T	C	11: 58,581,251	Y136H	probably damaging	Het
Olfr910	T	A	9: 38,539,256	Y120*	probably null	Het
Pfkm	A	G	15: 98,128,318	E598G	possibly damaging	Het
Phf2	A	T	13: 48,807,630	D861E	unknown	Het
Polr2a	A	G	11: 69,739,877		probably null	Het
Popdc2	G	A	16: 38,369,491	V167M	probably damaging	Het
Ptpn22	T	C	3: 103,885,798	S422P	probably benign	Het
Rasa2	T	C	9: 96,568,375	K490R	possibly damaging	Het
Rbfox3	T	A	11: 118,495,221	D286V	probably damaging	Het
Rdh13	A	G	7: 4,427,791	W223R	probably damaging	Het
Riok3	T	C	18: 12,128,929	S7P	probably benign	Het
Rnaseh2b	A	G	14: 62,353,632	E144G	probably benign	Het
Rnf20	C	T	4: 49,651,498	Q655*	probably null	Het
Rpap2	T	C	5: 107,603,550	Y8H	probably damaging	Het
Slc5a10	T	C	11: 61,709,602	Y181C	probably benign	Het
Snd1	G	T	6: 28,888,253	G896*	probably null	Het
Spast	C	T	17: 74,356,160	Q158*	probably null	Het
Tas2r104	G	A	6: 131,685,584	S54F	probably damaging	Het
Tcaf2	C	T	6: 42,628,017	W611*	probably null	Het
Timp4	G	A	6: 115,250,403		probably null	Het
Tmem45a	G	A	16: 56,823,570	S72L	probably benign	Het
Tnrc18	T	C	5: 142,788,703	T124A	possibly damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Ttn	T	C	2: 76,942,915	D2381G	probably damaging	Het
Uevld	T	C	7: 46,955,624	T41A	possibly damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Unc5d	T	C	8: 28,696,478	E527G	probably damaging	Het
Vmn2r125	C	T	4: 156,351,038	T237I	probably benign	Het
Vmn2r63	A	C	7: 42,933,614	I59S	probably benign	Het
Vps72	G	A	3: 95,118,695	S106N	probably benign	Het
Zan	A	C	5: 137,409,669		probably benign	Het
Zbtb38	T	C	9: 96,685,462	K1190E	probably benign	Het
Zc3h6	T	C	2: 129,017,358	V1103A	probably benign	Het
Zfp407	G	A	18: 84,562,157	T277I	probably damaging	Het
Zfp804b	A	G	5: 6,769,509	S1149P	probably damaging	Het

Other mutations in Kank1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Kank1	APN	19	25411758	missense	probably benign
IGL00435:Kank1	APN	19	25430236	missense	probably benign	0.41
IGL01105:Kank1	APN	19	25424316	missense	possibly damaging	0.80
IGL01974:Kank1	APN	19	25410232	missense	possibly damaging	0.87
IGL02031:Kank1	APN	19	25410702	missense	probably benign	0.01
IGL02125:Kank1	APN	19	25410703	missense	possibly damaging	0.90
IGL02152:Kank1	APN	19	25428172	missense	possibly damaging	0.51
IGL02211:Kank1	APN	19	25430338	missense	probably damaging	1.00
IGL02440:Kank1	APN	19	25432908	missense	probably damaging	1.00
IGL02448:Kank1	APN	19	25411375	missense	probably damaging	1.00
IGL02671:Kank1	APN	19	25428095	missense	probably damaging	1.00
IGL03102:Kank1	APN	19	25425918	missense	probably damaging	1.00
IGL03259:Kank1	APN	19	25430341	missense	probably damaging	1.00
IGL02802:Kank1	UTSW	19	25411599	missense	probably damaging	1.00
R0107:Kank1	UTSW	19	25430366	unclassified	probably benign
R0190:Kank1	UTSW	19	25409283	missense	probably benign	0.00
R0330:Kank1	UTSW	19	25424313	missense	probably benign	0.00
R0368:Kank1	UTSW	19	25410603	nonsense	probably null
R0399:Kank1	UTSW	19	25411242	missense	probably benign	0.00
R0426:Kank1	UTSW	19	25411473	missense	probably damaging	1.00
R0483:Kank1	UTSW	19	25425993	unclassified	probably benign
R1394:Kank1	UTSW	19	25428164	missense	probably damaging	1.00
R1495:Kank1	UTSW	19	25410349	missense	probably damaging	0.98
R1681:Kank1	UTSW	19	25410304	missense	possibly damaging	0.89
R1830:Kank1	UTSW	19	25411032	missense	probably benign	0.00
R1866:Kank1	UTSW	19	25411449	missense	probably benign	0.04
R2138:Kank1	UTSW	19	25411753	missense	probably benign	0.00
R2139:Kank1	UTSW	19	25411753	missense	probably benign	0.00
R2420:Kank1	UTSW	19	25410457	missense	probably damaging	1.00
R3153:Kank1	UTSW	19	25410688	missense	possibly damaging	0.89
R4164:Kank1	UTSW	19	25411072	missense	probably benign	0.10
R4670:Kank1	UTSW	19	25410580	missense	probably benign	0.00
R4685:Kank1	UTSW	19	25410034	missense	possibly damaging	0.66
R4843:Kank1	UTSW	19	25431007	missense	probably damaging	1.00
R4981:Kank1	UTSW	19	25411395	missense	probably benign	0.19
R5189:Kank1	UTSW	19	25424181	missense	probably damaging	1.00
R5280:Kank1	UTSW	19	25411305	missense	probably benign	0.01
R5330:Kank1	UTSW	19	25411329	missense	probably damaging	1.00
R5331:Kank1	UTSW	19	25411329	missense	probably damaging	1.00
R5435:Kank1	UTSW	19	25411143	missense	probably benign	0.04
R5500:Kank1	UTSW	19	25424332	missense	possibly damaging	0.46
R5894:Kank1	UTSW	19	25424200	missense	probably damaging	1.00
R6087:Kank1	UTSW	19	25409724	missense	probably benign	0.41
R6357:Kank1	UTSW	19	25411353	missense	probably benign	0.36
R6490:Kank1	UTSW	19	25410085	missense	probably damaging	1.00
R6504:Kank1	UTSW	19	25428154	missense	probably damaging	1.00
R6942:Kank1	UTSW	19	25424173	missense	possibly damaging	0.88
R7037:Kank1	UTSW	19	25430341	missense	probably damaging	1.00
R7405:Kank1	UTSW	19	25410319	nonsense	probably null
R7486:Kank1	UTSW	19	25410829	missense	probably damaging	0.99
R7602:Kank1	UTSW	19	25422161	missense	probably benign	0.01
R7701:Kank1	UTSW	19	25411765	critical splice donor site	probably null
R7765:Kank1	UTSW	19	25411205	frame shift	probably null
R7766:Kank1	UTSW	19	25411205	frame shift	probably null
R7768:Kank1	UTSW	19	25411205	frame shift	probably null
R7919:Kank1	UTSW	19	25431075	missense	probably damaging	1.00
R7974:Kank1	UTSW	19	25424220	missense	probably damaging	1.00
R7978:Kank1	UTSW	19	25411205	frame shift	probably null
R8017:Kank1	UTSW	19	25411204	frame shift	probably null
R8017:Kank1	UTSW	19	25411205	frame shift	probably null
R8020:Kank1	UTSW	19	25411205	frame shift	probably null
R8150:Kank1	UTSW	19	25410799	missense	possibly damaging	0.88
R8322:Kank1	UTSW	19	25378478	start gained	probably benign
R8374:Kank1	UTSW	19	25411641	missense	probably damaging	0.97
R8705:Kank1	UTSW	19	25411543	missense	probably damaging	1.00
R8855:Kank1	UTSW	19	25411338	missense	possibly damaging	0.87
R8866:Kank1	UTSW	19	25411338	missense	possibly damaging	0.87
R8891:Kank1	UTSW	19	25410075	missense	probably benign	0.32
R8894:Kank1	UTSW	19	25431014	missense	probably damaging	1.00
R8917:Kank1	UTSW	19	25409564	missense	probably damaging	0.99
R9217:Kank1	UTSW	19	25409580	missense	possibly damaging	0.92
R9301:Kank1	UTSW	19	25411434	missense	probably benign	0.00
R9431:Kank1	UTSW	19	25410502	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCCTCAGCACTATGGACAAGCAG -3'
(R):5'- TGTAGTTCTCAGCCAGCAACGTC -3'

Sequencing Primer
(F):5'- TATGGACAAGCAGACCAGC -3'
(R):5'- TGTAGTGATCCAAGCCAGTC -3'

Posted On

2014-05-14