Incidental Mutation 'R1699:Spag4'
ID192482
Institutional Source Beutler Lab
Gene Symbol Spag4
Ensembl Gene ENSMUSG00000038180
Gene Namesperm associated antigen 4
Synonyms1700041K21Rik, Sun4
MMRRC Submission 039732-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1699 (G1)
Quality Score172
Status Not validated
Chromosome2
Chromosomal Location156065175-156070617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156065422 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 21 (Y21H)
Ref Sequence ENSEMBL: ENSMUSP00000036484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038860] [ENSMUST00000137966] [ENSMUST00000138178]
Predicted Effect probably damaging
Transcript: ENSMUST00000038860
AA Change: Y21H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036484
Gene: ENSMUSG00000038180
AA Change: Y21H

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 19 37 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 166 188 N/A INTRINSIC
low complexity region 214 222 N/A INTRINSIC
Pfam:Sad1_UNC 293 426 1.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125996
Predicted Effect probably benign
Transcript: ENSMUST00000131144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136765
Predicted Effect probably benign
Transcript: ENSMUST00000137966
SMART Domains Protein: ENSMUSP00000118715
Gene: ENSMUSG00000038180

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
coiled coil region 112 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149139
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mammalian sperm flagellum contains two cytoskeletal structures associated with the axoneme: the outer dense fibers surrounding the axoneme in the midpiece and principal piece and the fibrous sheath surrounding the outer dense fibers in the principal piece of the tail. Defects in these structures are associated with abnormal tail morphology, reduced sperm motility, and infertility. In the rat, the protein encoded by this gene associates with an outer dense fiber protein via a leucine zipper motif and localizes to the microtubules of the manchette and axoneme during sperm tail development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show disrupted spermiogenesis, severe defects in sperm head formation, abnormal manchette morphology, globozoospermia, and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A G 5: 30,483,866 probably null Het
Abca2 A G 2: 25,447,351 E2406G possibly damaging Het
Adam6b T A 12: 113,490,585 F341I probably benign Het
Adam8 A T 7: 139,983,311 N767K possibly damaging Het
AI481877 T C 4: 59,113,926 K13R unknown Het
Aig1 T C 10: 13,868,622 D46G possibly damaging Het
Alms1 A G 6: 85,622,880 I2032V possibly damaging Het
Ankrd16 A G 2: 11,784,393 I264V probably benign Het
Areg T G 5: 91,143,498 V100G probably damaging Het
Bcan A G 3: 87,989,236 Y718H probably damaging Het
Brsk2 T A 7: 141,985,463 I188N probably damaging Het
Ccdc189 A T 7: 127,586,856 probably null Het
Cdt1 T C 8: 122,569,983 Y203H probably damaging Het
Chil3 A C 3: 106,160,366 probably null Het
Cth A G 3: 157,907,436 L253P probably damaging Het
Cyp11b1 A G 15: 74,840,817 F132L possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah11 A G 12: 118,190,868 S226P probably damaging Het
Egfr A T 11: 16,859,019 Q71L probably benign Het
Eml6 T A 11: 29,746,282 K1940* probably null Het
Epn2 T A 11: 61,523,188 K391* probably null Het
Erich1 A T 8: 14,090,259 S2T possibly damaging Het
Evi5 A C 5: 107,818,920 L245R probably damaging Het
Evpl T C 11: 116,227,588 Y731C probably damaging Het
Exoc3l G A 8: 105,295,013 H128Y probably benign Het
Extl1 G A 4: 134,364,583 Q320* probably null Het
Fam71a T A 1: 191,163,821 E208D probably benign Het
Fam91a1 T A 15: 58,432,948 S416T probably benign Het
Fam96b A G 8: 104,640,086 V132A probably damaging Het
Fat3 A T 9: 15,938,398 S3903T probably damaging Het
Fer1l4 A G 2: 156,029,685 F1392L probably benign Het
Fstl4 T C 11: 53,168,178 I488T possibly damaging Het
Gak A T 5: 108,604,377 Y338* probably null Het
Glp2r T C 11: 67,757,541 T112A probably benign Het
Glrb G A 3: 80,861,774 T180I probably damaging Het
Gm10118 C T 10: 63,926,892 probably benign Het
Gpr19 A T 6: 134,870,229 F72I possibly damaging Het
Grin3b C A 10: 79,975,882 N740K probably damaging Het
Gstk1 A T 6: 42,246,601 T42S probably benign Het
Hoxd1 G A 2: 74,764,282 A294T probably benign Het
Hspg2 T A 4: 137,548,012 probably null Het
Ift74 A T 4: 94,685,703 N472I probably benign Het
Il1a C T 2: 129,302,893 D202N probably damaging Het
Islr T C 9: 58,157,495 D243G probably damaging Het
Kif21a C T 15: 90,959,743 E1098K probably damaging Het
Krtap16-1 T C 11: 99,986,026 E184G probably damaging Het
Lrp1b A G 2: 41,185,962 I1889T possibly damaging Het
Mcpt4 A G 14: 56,059,959 *247Q probably null Het
Megf10 T C 18: 57,277,730 probably null Het
Mettl2 T A 11: 105,139,718 H373Q probably benign Het
Mocos A G 18: 24,683,216 K617E probably damaging Het
Ms4a8a A G 19: 11,076,397 I115T probably damaging Het
Ndst1 T C 18: 60,695,508 Y658C probably damaging Het
Nin C A 12: 70,045,563 K657N possibly damaging Het
Nin G A 12: 70,030,938 A1031V probably benign Het
Noc4l G A 5: 110,649,847 R344* probably null Het
Notch2 T C 3: 98,145,127 S1980P probably damaging Het
Npat C T 9: 53,562,660 S584L probably benign Het
Nphp4 A G 4: 152,496,664 T102A probably damaging Het
Olfml2b A G 1: 170,645,073 N51S possibly damaging Het
Olfr1042 T C 2: 86,159,936 I145V probably benign Het
Olfr138 A G 17: 38,275,041 K90R probably benign Het
Olfr1388 T A 11: 49,444,289 I146N possibly damaging Het
Olfr153 A G 2: 87,532,083 T17A probably benign Het
Pced1b T A 15: 97,384,877 W266R probably damaging Het
Pdcd6ip A G 9: 113,678,354 V378A probably damaging Het
Pde8b T A 13: 95,032,866 K683N probably damaging Het
Pfas T G 11: 68,998,046 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plcd4 T G 1: 74,548,235 S51R probably benign Het
Plekhh2 T A 17: 84,577,184 Y775* probably null Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Ppp4r3b C T 11: 29,213,765 T47I possibly damaging Het
Pter A T 2: 12,994,761 D169V probably damaging Het
Ptpn12 A G 5: 20,998,170 S537P probably benign Het
Ptpru T A 4: 131,779,050 D1067V probably damaging Het
Rcn1 A T 2: 105,399,005 D67E probably damaging Het
Rfc4 T C 16: 23,114,233 E318G probably benign Het
Samd13 C A 3: 146,662,714 R41L probably benign Het
Slc6a2 T C 8: 92,972,812 I156T possibly damaging Het
Spag16 T C 1: 69,996,856 F348L probably benign Het
Stam2 G A 2: 52,703,175 A368V possibly damaging Het
Stc1 A T 14: 69,038,327 M190L probably benign Het
Stxbp1 A G 2: 32,800,617 L475P probably damaging Het
Syn3 A T 10: 86,080,211 Y304N probably damaging Het
Tbc1d15 G T 10: 115,220,314 T251K probably benign Het
Tbpl2 A T 2: 24,095,045 M29K probably benign Het
Tead3 T G 17: 28,334,724 Q170H possibly damaging Het
Tpbpb T C 13: 60,902,163 N51D probably benign Het
Tstd3 A G 4: 21,759,400 M124T probably benign Het
Ttyh1 T A 7: 4,119,696 H14Q possibly damaging Het
Tubgcp4 G A 2: 121,189,893 W449* probably null Het
Txndc11 A G 16: 11,087,775 probably null Het
Usp24 T A 4: 106,438,827 D2615E probably damaging Het
Vars A G 17: 35,014,758 E1020G possibly damaging Het
Vmn2r58 A G 7: 41,860,527 I542T probably benign Het
Vwf A T 6: 125,685,900 Y2749F possibly damaging Het
Vwf A G 6: 125,643,069 Y1570C probably damaging Het
Zfand1 A C 3: 10,341,055 V198G possibly damaging Het
Zfp536 G A 7: 37,569,454 T179I probably damaging Het
Zfp599 T C 9: 22,250,404 Y155C probably benign Het
Other mutations in Spag4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Spag4 APN 2 156069332 missense possibly damaging 0.88
IGL01843:Spag4 APN 2 156068497 missense probably benign 0.04
IGL02200:Spag4 APN 2 156066597 missense probably benign 0.14
IGL02506:Spag4 APN 2 156069222 missense probably damaging 1.00
IGL02570:Spag4 APN 2 156068444 missense possibly damaging 0.60
IGL03302:Spag4 APN 2 156068420 missense probably damaging 0.97
R0127:Spag4 UTSW 2 156068042 missense probably damaging 0.99
R0314:Spag4 UTSW 2 156067309 unclassified probably benign
R0441:Spag4 UTSW 2 156067979 missense probably damaging 1.00
R5270:Spag4 UTSW 2 156065933 intron probably benign
R5293:Spag4 UTSW 2 156066191 missense probably benign 0.07
R6092:Spag4 UTSW 2 156065776 intron probably benign
R7138:Spag4 UTSW 2 156066599 missense probably benign 0.00
R7300:Spag4 UTSW 2 156065621 missense probably benign 0.06
R7898:Spag4 UTSW 2 156069324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGACGGTGACAACAGCACAG -3'
(R):5'- AGTCTCAATCAGTGGAAACCGCCC -3'

Sequencing Primer
(F):5'- CAACAGCACAGCAGCGG -3'
(R):5'- TTCTGCACCCAGGTccg -3'
Posted On2014-05-14