Mutagenetix > Incidental Mutation

Incidental Mutation 'R1699:Usp24'

192494

Institutional Source

Beutler Lab

Gene Symbol

Usp24

Ensembl Gene

ENSMUSG00000028514

Gene Name

ubiquitin specific peptidase 24

Synonyms

2810030C21Rik, 2700066K03Rik

MMRRC Submission

039732-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1699 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106316213-106441322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 106438827 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 2615 (D2615E)

Ref Sequence

ENSEMBL: ENSMUSP00000133095 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049507] [ENSMUST00000094933] [ENSMUST00000165709]

AlphaFold

B1AY13

Predicted Effect

probably benign
Transcript: ENSMUST00000049507

SMART Domains

Protein: ENSMUSP00000055757
Gene: ENSMUSG00000044254

Domain	Start	End	E-Value	Type
low complexity region	12	27	N/A	INTRINSIC
Pfam:Peptidase_S8	180	438	3.1e-34	PFAM
low complexity region	471	481	N/A	INTRINSIC
low complexity region	490	500	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000094933
AA Change: D2614E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: D2614E

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	882	6e-7	SMART
low complexity region	1031	1059	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1365	1378	N/A	INTRINSIC
Pfam:UCH	1685	2036	3.7e-54	PFAM
Pfam:UCH_1	1686	1993	1.8e-27	PFAM
low complexity region	2066	2081	N/A	INTRINSIC
low complexity region	2256	2267	N/A	INTRINSIC
low complexity region	2576	2592	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165709
AA Change: D2615E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: D2615E

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	883	8e-7	SMART
low complexity region	1032	1060	N/A	INTRINSIC
low complexity region	1125	1151	N/A	INTRINSIC
low complexity region	1366	1379	N/A	INTRINSIC
Pfam:UCH	1686	2037	2e-49	PFAM
Pfam:UCH_1	1687	1994	4e-24	PFAM
low complexity region	2067	2082	N/A	INTRINSIC
low complexity region	2257	2268	N/A	INTRINSIC
low complexity region	2577	2593	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C02Rik	A	G	5: 30,483,866		probably null	Het
Abca2	A	G	2: 25,447,351	E2406G	possibly damaging	Het
Adam6b	T	A	12: 113,490,585	F341I	probably benign	Het
Adam8	A	T	7: 139,983,311	N767K	possibly damaging	Het
AI481877	T	C	4: 59,113,926	K13R	unknown	Het
Aig1	T	C	10: 13,868,622	D46G	possibly damaging	Het
Alms1	A	G	6: 85,622,880	I2032V	possibly damaging	Het
Ankrd16	A	G	2: 11,784,393	I264V	probably benign	Het
Areg	T	G	5: 91,143,498	V100G	probably damaging	Het
Bcan	A	G	3: 87,989,236	Y718H	probably damaging	Het
Brsk2	T	A	7: 141,985,463	I188N	probably damaging	Het
Ccdc189	A	T	7: 127,586,856		probably null	Het
Cdt1	T	C	8: 122,569,983	Y203H	probably damaging	Het
Chil3	A	C	3: 106,160,366		probably null	Het
Cth	A	G	3: 157,907,436	L253P	probably damaging	Het
Cyp11b1	A	G	15: 74,840,817	F132L	possibly damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dnah11	A	G	12: 118,190,868	S226P	probably damaging	Het
Egfr	A	T	11: 16,859,019	Q71L	probably benign	Het
Eml6	T	A	11: 29,746,282	K1940*	probably null	Het
Epn2	T	A	11: 61,523,188	K391*	probably null	Het
Erich1	A	T	8: 14,090,259	S2T	possibly damaging	Het
Evi5	A	C	5: 107,818,920	L245R	probably damaging	Het
Evpl	T	C	11: 116,227,588	Y731C	probably damaging	Het
Exoc3l	G	A	8: 105,295,013	H128Y	probably benign	Het
Extl1	G	A	4: 134,364,583	Q320*	probably null	Het
Fam71a	T	A	1: 191,163,821	E208D	probably benign	Het
Fam91a1	T	A	15: 58,432,948	S416T	probably benign	Het
Fam96b	A	G	8: 104,640,086	V132A	probably damaging	Het
Fat3	A	T	9: 15,938,398	S3903T	probably damaging	Het
Fer1l4	A	G	2: 156,029,685	F1392L	probably benign	Het
Fstl4	T	C	11: 53,168,178	I488T	possibly damaging	Het
Gak	A	T	5: 108,604,377	Y338*	probably null	Het
Glp2r	T	C	11: 67,757,541	T112A	probably benign	Het
Glrb	G	A	3: 80,861,774	T180I	probably damaging	Het
Gm10118	C	T	10: 63,926,892		probably benign	Het
Gpr19	A	T	6: 134,870,229	F72I	possibly damaging	Het
Grin3b	C	A	10: 79,975,882	N740K	probably damaging	Het
Gstk1	A	T	6: 42,246,601	T42S	probably benign	Het
Hoxd1	G	A	2: 74,764,282	A294T	probably benign	Het
Hspg2	T	A	4: 137,548,012		probably null	Het
Ift74	A	T	4: 94,685,703	N472I	probably benign	Het
Il1a	C	T	2: 129,302,893	D202N	probably damaging	Het
Islr	T	C	9: 58,157,495	D243G	probably damaging	Het
Kif21a	C	T	15: 90,959,743	E1098K	probably damaging	Het
Krtap16-1	T	C	11: 99,986,026	E184G	probably damaging	Het
Lrp1b	A	G	2: 41,185,962	I1889T	possibly damaging	Het
Mcpt4	A	G	14: 56,059,959	*247Q	probably null	Het
Megf10	T	C	18: 57,277,730		probably null	Het
Mettl2	T	A	11: 105,139,718	H373Q	probably benign	Het
Mocos	A	G	18: 24,683,216	K617E	probably damaging	Het
Ms4a8a	A	G	19: 11,076,397	I115T	probably damaging	Het
Ndst1	T	C	18: 60,695,508	Y658C	probably damaging	Het
Nin	G	A	12: 70,030,938	A1031V	probably benign	Het
Nin	C	A	12: 70,045,563	K657N	possibly damaging	Het
Noc4l	G	A	5: 110,649,847	R344*	probably null	Het
Notch2	T	C	3: 98,145,127	S1980P	probably damaging	Het
Npat	C	T	9: 53,562,660	S584L	probably benign	Het
Nphp4	A	G	4: 152,496,664	T102A	probably damaging	Het
Olfml2b	A	G	1: 170,645,073	N51S	possibly damaging	Het
Olfr1042	T	C	2: 86,159,936	I145V	probably benign	Het
Olfr138	A	G	17: 38,275,041	K90R	probably benign	Het
Olfr1388	T	A	11: 49,444,289	I146N	possibly damaging	Het
Olfr153	A	G	2: 87,532,083	T17A	probably benign	Het
Pced1b	T	A	15: 97,384,877	W266R	probably damaging	Het
Pdcd6ip	A	G	9: 113,678,354	V378A	probably damaging	Het
Pde8b	T	A	13: 95,032,866	K683N	probably damaging	Het
Pfas	T	G	11: 68,998,046		probably null	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Plcd4	T	G	1: 74,548,235	S51R	probably benign	Het
Plekhh2	T	A	17: 84,577,184	Y775*	probably null	Het
Polr3a	G	A	14: 24,484,164	P91L	probably damaging	Het
Ppp4r3b	C	T	11: 29,213,765	T47I	possibly damaging	Het
Pter	A	T	2: 12,994,761	D169V	probably damaging	Het
Ptpn12	A	G	5: 20,998,170	S537P	probably benign	Het
Ptpru	T	A	4: 131,779,050	D1067V	probably damaging	Het
Rcn1	A	T	2: 105,399,005	D67E	probably damaging	Het
Rfc4	T	C	16: 23,114,233	E318G	probably benign	Het
Samd13	C	A	3: 146,662,714	R41L	probably benign	Het
Slc6a2	T	C	8: 92,972,812	I156T	possibly damaging	Het
Spag16	T	C	1: 69,996,856	F348L	probably benign	Het
Spag4	T	C	2: 156,065,422	Y21H	probably damaging	Het
Stam2	G	A	2: 52,703,175	A368V	possibly damaging	Het
Stc1	A	T	14: 69,038,327	M190L	probably benign	Het
Stxbp1	A	G	2: 32,800,617	L475P	probably damaging	Het
Syn3	A	T	10: 86,080,211	Y304N	probably damaging	Het
Tbc1d15	G	T	10: 115,220,314	T251K	probably benign	Het
Tbpl2	A	T	2: 24,095,045	M29K	probably benign	Het
Tead3	T	G	17: 28,334,724	Q170H	possibly damaging	Het
Tpbpb	T	C	13: 60,902,163	N51D	probably benign	Het
Tstd3	A	G	4: 21,759,400	M124T	probably benign	Het
Ttyh1	T	A	7: 4,119,696	H14Q	possibly damaging	Het
Tubgcp4	G	A	2: 121,189,893	W449*	probably null	Het
Txndc11	A	G	16: 11,087,775		probably null	Het
Vars	A	G	17: 35,014,758	E1020G	possibly damaging	Het
Vmn2r58	A	G	7: 41,860,527	I542T	probably benign	Het
Vwf	A	G	6: 125,643,069	Y1570C	probably damaging	Het
Vwf	A	T	6: 125,685,900	Y2749F	possibly damaging	Het
Zfand1	A	C	3: 10,341,055	V198G	possibly damaging	Het
Zfp536	G	A	7: 37,569,454	T179I	probably damaging	Het
Zfp599	T	C	9: 22,250,404	Y155C	probably benign	Het

Other mutations in Usp24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Usp24	APN	4	106359091	missense	probably benign
IGL00340:Usp24	APN	4	106401139	missense	probably damaging	0.99
IGL00480:Usp24	APN	4	106368106	missense	probably damaging	0.99
IGL00548:Usp24	APN	4	106341298	missense	probably damaging	0.96
IGL00655:Usp24	APN	4	106390318	missense	probably damaging	0.99
IGL00674:Usp24	APN	4	106372679	splice site	probably benign
IGL00718:Usp24	APN	4	106409704	missense	probably benign	0.10
IGL00803:Usp24	APN	4	106385526	splice site	probably benign
IGL01161:Usp24	APN	4	106436844	missense	probably benign	0.02
IGL01344:Usp24	APN	4	106379385	missense	possibly damaging	0.73
IGL01374:Usp24	APN	4	106380099	missense	possibly damaging	0.86
IGL01485:Usp24	APN	4	106362232	missense	probably benign	0.01
IGL01736:Usp24	APN	4	106423461	missense	probably benign	0.00
IGL01737:Usp24	APN	4	106387734	missense	probably benign	0.03
IGL01862:Usp24	APN	4	106408898	splice site	probably benign
IGL01981:Usp24	APN	4	106375768	splice site	probably benign
IGL02090:Usp24	APN	4	106411426	missense	possibly damaging	0.55
IGL02275:Usp24	APN	4	106387493	missense	probably damaging	1.00
IGL02352:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02359:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02391:Usp24	APN	4	106407129	missense	possibly damaging	0.60
IGL02418:Usp24	APN	4	106436360	missense	probably benign	0.07
IGL02537:Usp24	APN	4	106392367	missense	probably damaging	1.00
IGL02638:Usp24	APN	4	106438770	splice site	probably benign
IGL02638:Usp24	APN	4	106438772	splice site	probably benign
IGL02830:Usp24	APN	4	106347387	missense	possibly damaging	0.79
IGL03125:Usp24	APN	4	106392402	missense	probably benign	0.09
IGL03280:Usp24	APN	4	106380430	missense	probably damaging	1.00
IGL03350:Usp24	APN	4	106371079	nonsense	probably null
BB010:Usp24	UTSW	4	106428489	missense	probably benign
BB020:Usp24	UTSW	4	106428489	missense	probably benign
IGL03098:Usp24	UTSW	4	106371033	missense	probably benign	0.11
R0035:Usp24	UTSW	4	106368027	missense	probably benign	0.18
R0044:Usp24	UTSW	4	106412084	splice site	probably benign
R0086:Usp24	UTSW	4	106392360	missense	probably damaging	0.98
R0125:Usp24	UTSW	4	106397299	missense	possibly damaging	0.76
R0197:Usp24	UTSW	4	106407133	missense	probably damaging	1.00
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0491:Usp24	UTSW	4	106402105	missense	probably benign	0.41
R0687:Usp24	UTSW	4	106420504	missense	probably damaging	1.00
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0973:Usp24	UTSW	4	106413678	splice site	probably null
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0974:Usp24	UTSW	4	106371079	nonsense	probably null
R0974:Usp24	UTSW	4	106413678	splice site	probably null
R1163:Usp24	UTSW	4	106420960	missense	probably benign
R1293:Usp24	UTSW	4	106423553	missense	probably benign	0.19
R1333:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R1476:Usp24	UTSW	4	106361933	missense	probably damaging	1.00
R1728:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1729:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1753:Usp24	UTSW	4	106377559	missense	probably benign	0.04
R1917:Usp24	UTSW	4	106410286	missense	probably damaging	1.00
R2045:Usp24	UTSW	4	106400980	missense	possibly damaging	0.54
R2424:Usp24	UTSW	4	106399113	critical splice donor site	probably null
R2436:Usp24	UTSW	4	106409645	nonsense	probably null
R2513:Usp24	UTSW	4	106379405	splice site	probably null
R3824:Usp24	UTSW	4	106379066	missense	probably benign
R3831:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3833:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3982:Usp24	UTSW	4	106387883	missense	probably benign	0.38
R4022:Usp24	UTSW	4	106379224	splice site	probably benign
R4067:Usp24	UTSW	4	106359089	missense	possibly damaging	0.68
R4175:Usp24	UTSW	4	106316773	missense	probably benign	0.00
R4766:Usp24	UTSW	4	106416048	missense	probably damaging	1.00
R4771:Usp24	UTSW	4	106362180	splice site	probably null
R4798:Usp24	UTSW	4	106360162	missense	possibly damaging	0.82
R4809:Usp24	UTSW	4	106413676	critical splice donor site	probably null
R4822:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R4906:Usp24	UTSW	4	106388637	missense	probably benign	0.20
R4934:Usp24	UTSW	4	106426546	missense	probably benign	0.29
R5074:Usp24	UTSW	4	106420447	missense	probably benign	0.12
R5151:Usp24	UTSW	4	106399112	critical splice donor site	probably null
R5220:Usp24	UTSW	4	106382303	missense	possibly damaging	0.69
R5279:Usp24	UTSW	4	106385424	missense	possibly damaging	0.94
R5280:Usp24	UTSW	4	106341214	missense	probably benign	0.18
R5285:Usp24	UTSW	4	106407033	missense	probably benign	0.00
R5292:Usp24	UTSW	4	106418263	missense	probably benign	0.06
R5294:Usp24	UTSW	4	106362357	missense	possibly damaging	0.53
R5394:Usp24	UTSW	4	106408013	missense	probably damaging	1.00
R5517:Usp24	UTSW	4	106375674	missense	probably benign	0.02
R5522:Usp24	UTSW	4	106372721	missense	probably damaging	1.00
R5546:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R5756:Usp24	UTSW	4	106362483	missense	probably damaging	1.00
R5910:Usp24	UTSW	4	106380468	missense	probably damaging	0.99
R5972:Usp24	UTSW	4	106368067	missense	probably damaging	0.98
R6285:Usp24	UTSW	4	106374100	splice site	probably null
R6370:Usp24	UTSW	4	106380521	missense	probably null	0.20
R6630:Usp24	UTSW	4	106387835	missense	possibly damaging	0.69
R6754:Usp24	UTSW	4	106360420	missense	probably damaging	1.00
R7027:Usp24	UTSW	4	106362244	missense	probably benign	0.21
R7088:Usp24	UTSW	4	106387546	missense	probably damaging	1.00
R7129:Usp24	UTSW	4	106362215	missense	probably damaging	1.00
R7131:Usp24	UTSW	4	106382303	missense	possibly damaging	0.69
R7156:Usp24	UTSW	4	106387919	critical splice donor site	probably null
R7174:Usp24	UTSW	4	106362681	splice site	probably null
R7236:Usp24	UTSW	4	106406305	splice site	probably null
R7403:Usp24	UTSW	4	106407035	missense	possibly damaging	0.79
R7424:Usp24	UTSW	4	106379107	missense	probably benign	0.00
R7475:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R7505:Usp24	UTSW	4	106379079	missense	probably damaging	1.00
R7782:Usp24	UTSW	4	106316574	missense	probably damaging	1.00
R7900:Usp24	UTSW	4	106409400	missense	probably damaging	1.00
R7933:Usp24	UTSW	4	106428489	missense	probably benign
R7940:Usp24	UTSW	4	106430544	missense	probably damaging	0.98
R8271:Usp24	UTSW	4	106428514	missense	probably damaging	0.98
R8348:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8448:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8483:Usp24	UTSW	4	106373756	missense	probably damaging	1.00
R8546:Usp24	UTSW	4	106402129	missense	probably benign	0.01
R8798:Usp24	UTSW	4	106379239	missense	probably benign	0.00
R8822:Usp24	UTSW	4	106412213	missense	probably benign	0.17
R8992:Usp24	UTSW	4	106377565	missense	probably benign	0.36
R9002:Usp24	UTSW	4	106418215	missense	possibly damaging	0.72
R9037:Usp24	UTSW	4	106379054	missense	probably damaging	0.99
R9068:Usp24	UTSW	4	106375678	missense	probably benign	0.09
R9096:Usp24	UTSW	4	106397311	missense	probably benign	0.00
R9180:Usp24	UTSW	4	106359050	missense	possibly damaging	0.71
R9199:Usp24	UTSW	4	106387484	missense	probably damaging	1.00
R9201:Usp24	UTSW	4	106420530	missense	probably benign	0.36
R9251:Usp24	UTSW	4	106360518	missense	probably benign	0.19
R9423:Usp24	UTSW	4	106431670	missense	probably damaging	1.00
R9459:Usp24	UTSW	4	106342358	missense	probably damaging	1.00
R9472:Usp24	UTSW	4	106403931	missense	probably benign	0.00
R9483:Usp24	UTSW	4	106362182	missense	probably damaging	0.99
R9534:Usp24	UTSW	4	106407115	missense	probably damaging	0.97
R9653:Usp24	UTSW	4	106347367	missense	probably benign	0.03
R9712:Usp24	UTSW	4	106347367	missense	probably benign	0.03
X0024:Usp24	UTSW	4	106360446	missense	probably benign	0.09
X0028:Usp24	UTSW	4	106368055	missense	probably benign	0.01
X0066:Usp24	UTSW	4	106355731	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- CTGGTGGCTTAGTAAGACCACACG -3'
(R):5'- ATGCACATGTAGACGCTGGGAC -3'

Sequencing Primer
(F):5'- GCAAATGCTTTGCATGACCC -3'
(R):5'- AGCTGGTCCACATTGCAGAA -3'

Posted On

2014-05-14