Mutagenetix > Incidental Mutation

Incidental Mutation 'R1699:Hspg2'

192497

Institutional Source

Beutler Lab

Gene Symbol

Hspg2

Ensembl Gene

ENSMUSG00000028763

Gene Name

perlecan (heparan sulfate proteoglycan 2)

Synonyms

Plc, Pcn, per

MMRRC Submission

039732-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1699 (G1)

Quality Score

145

Status

Not validated

Chromosome

Chromosomal Location

137468769-137570630 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 137548012 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000131316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030547] [ENSMUST00000171332]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000030547

SMART Domains

Protein: ENSMUSP00000030547
Gene: ENSMUSG00000028763

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	53	78	N/A	INTRINSIC
SEA	80	194	4.94e-18	SMART
LDLa	198	236	4.51e-12	SMART
low complexity region	253	267	N/A	INTRINSIC
LDLa	284	321	1.62e-13	SMART
LDLa	324	361	2.59e-12	SMART
LDLa	367	405	3.86e-11	SMART
IGc2	419	486	4.06e-13	SMART
LamB	590	717	7.45e-54	SMART
EGF_Lam	764	811	6.05e-14	SMART
EGF_Lam	814	869	3.82e-2	SMART
EGF_like	871	921	6.74e-1	SMART
low complexity region	934	939	N/A	INTRINSIC
LamB	985	1112	2.87e-55	SMART
Pfam:Laminin_EGF	1113	1156	7.5e-5	PFAM
EGF_Lam	1159	1206	1.1e-11	SMART
EGF_Lam	1209	1263	2.46e-5	SMART
EGF_Lam	1275	1322	4.96e-10	SMART
LamB	1391	1516	5.3e-59	SMART
EGF_like	1516	1560	3.36e0	SMART
EGF_Lam	1563	1610	2.66e-10	SMART
EGF_Lam	1613	1668	3.73e-5	SMART
IGc2	1688	1752	1.76e-8	SMART
IGc2	1783	1846	5.97e-11	SMART
IGc2	1877	1939	8.57e-12	SMART
IGc2	1967	2031	1.82e-15	SMART
IGc2	2056	2117	4.81e-15	SMART
IGc2	2157	2216	1.37e-10	SMART
IGc2	2251	2312	5.88e-10	SMART
low complexity region	2333	2344	N/A	INTRINSIC
IGc2	2347	2408	1.97e-11	SMART
IGc2	2441	2502	1.59e-15	SMART
low complexity region	2517	2528	N/A	INTRINSIC
IGc2	2538	2599	3.08e-13	SMART
IGc2	2634	2695	9.25e-17	SMART
low complexity region	2704	2728	N/A	INTRINSIC
IGc2	2731	2792	1.84e-11	SMART
IGc2	2828	2889	2.11e-11	SMART
IGc2	2926	2987	3.25e-12	SMART
IG	3017	3098	3.62e-10	SMART
IGc2	3114	3180	9.05e-11	SMART
IGc2	3212	3273	2.44e-16	SMART
IGc2	3299	3360	2.26e-11	SMART
IGc2	3400	3461	6.81e-6	SMART
IGc2	3489	3550	1.59e-15	SMART
IGc2	3575	3636	2.54e-14	SMART
LamG	3672	3813	3.41e-39	SMART
EGF	3832	3866	6.91e-9	SMART
EGF	3872	3907	4.46e-3	SMART
LamG	3934	4070	4.78e-43	SMART
EGF	4092	4126	1.17e-6	SMART
EGF	4131	4161	1.87e-5	SMART
LamG	4211	4348	1.33e-41	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000171332

SMART Domains

Protein: ENSMUSP00000131316
Gene: ENSMUSG00000028763

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	53	78	N/A	INTRINSIC
SEA	80	194	4.94e-18	SMART
LDLa	198	236	4.51e-12	SMART
low complexity region	253	267	N/A	INTRINSIC
LDLa	284	321	1.62e-13	SMART
LDLa	324	361	2.59e-12	SMART
LDLa	367	405	3.86e-11	SMART
IGc2	419	486	4.06e-13	SMART
LamB	590	717	7.45e-54	SMART
EGF_Lam	764	811	6.05e-14	SMART
EGF_Lam	814	869	3.82e-2	SMART
EGF_like	871	921	6.74e-1	SMART
low complexity region	934	939	N/A	INTRINSIC
LamB	985	1112	2.87e-55	SMART
Pfam:Laminin_EGF	1114	1156	7.9e-5	PFAM
EGF_Lam	1159	1206	1.1e-11	SMART
EGF_Lam	1209	1263	2.46e-5	SMART
EGF_Lam	1275	1322	4.96e-10	SMART
LamB	1391	1516	5.3e-59	SMART
EGF_like	1516	1560	3.36e0	SMART
EGF_Lam	1563	1610	2.66e-10	SMART
EGF_Lam	1613	1668	3.73e-5	SMART
IGc2	1688	1752	1.76e-8	SMART
IGc2	1783	1846	5.97e-11	SMART
IGc2	1877	1939	8.57e-12	SMART
IGc2	1967	2031	1.82e-15	SMART
IGc2	2062	2123	4.81e-15	SMART
IGc2	2163	2222	1.37e-10	SMART
IGc2	2257	2318	5.88e-10	SMART
low complexity region	2339	2350	N/A	INTRINSIC
IGc2	2353	2414	1.97e-11	SMART
IGc2	2447	2508	1.59e-15	SMART
low complexity region	2523	2534	N/A	INTRINSIC
IGc2	2544	2605	3.08e-13	SMART
IGc2	2640	2701	9.25e-17	SMART
low complexity region	2710	2734	N/A	INTRINSIC
IGc2	2737	2798	1.84e-11	SMART
IGc2	2836	2897	2.11e-11	SMART
IGc2	2934	2995	3.25e-12	SMART
IG	3025	3106	3.62e-10	SMART
IGc2	3122	3188	9.05e-11	SMART
IGc2	3220	3281	2.44e-16	SMART
IGc2	3307	3368	2.26e-11	SMART
IGc2	3408	3469	6.81e-6	SMART
IGc2	3497	3558	1.59e-15	SMART
IGc2	3583	3644	2.54e-14	SMART
LamG	3680	3821	3.41e-39	SMART
EGF	3840	3874	6.91e-9	SMART
EGF	3880	3915	4.46e-3	SMART
LamG	3942	4078	4.78e-43	SMART
EGF	4100	4134	1.17e-6	SMART
EGF	4139	4169	1.87e-5	SMART
LamG	4219	4356	1.33e-41	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous targeted null mutants die either at embryonic day 10.5 with cardiac outflow defects and/or brain exencephaly or at birth with skeletal dysplasia including micromelia and craniofacial defects. An exon 3 deletion mutant shows only a lens defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C02Rik	A	G	5: 30,483,866		probably null	Het
Abca2	A	G	2: 25,447,351	E2406G	possibly damaging	Het
Adam6b	T	A	12: 113,490,585	F341I	probably benign	Het
Adam8	A	T	7: 139,983,311	N767K	possibly damaging	Het
AI481877	T	C	4: 59,113,926	K13R	unknown	Het
Aig1	T	C	10: 13,868,622	D46G	possibly damaging	Het
Alms1	A	G	6: 85,622,880	I2032V	possibly damaging	Het
Ankrd16	A	G	2: 11,784,393	I264V	probably benign	Het
Areg	T	G	5: 91,143,498	V100G	probably damaging	Het
Bcan	A	G	3: 87,989,236	Y718H	probably damaging	Het
Brsk2	T	A	7: 141,985,463	I188N	probably damaging	Het
Ccdc189	A	T	7: 127,586,856		probably null	Het
Cdt1	T	C	8: 122,569,983	Y203H	probably damaging	Het
Chil3	A	C	3: 106,160,366		probably null	Het
Cth	A	G	3: 157,907,436	L253P	probably damaging	Het
Cyp11b1	A	G	15: 74,840,817	F132L	possibly damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dnah11	A	G	12: 118,190,868	S226P	probably damaging	Het
Egfr	A	T	11: 16,859,019	Q71L	probably benign	Het
Eml6	T	A	11: 29,746,282	K1940*	probably null	Het
Epn2	T	A	11: 61,523,188	K391*	probably null	Het
Erich1	A	T	8: 14,090,259	S2T	possibly damaging	Het
Evi5	A	C	5: 107,818,920	L245R	probably damaging	Het
Evpl	T	C	11: 116,227,588	Y731C	probably damaging	Het
Exoc3l	G	A	8: 105,295,013	H128Y	probably benign	Het
Extl1	G	A	4: 134,364,583	Q320*	probably null	Het
Fam71a	T	A	1: 191,163,821	E208D	probably benign	Het
Fam91a1	T	A	15: 58,432,948	S416T	probably benign	Het
Fam96b	A	G	8: 104,640,086	V132A	probably damaging	Het
Fat3	A	T	9: 15,938,398	S3903T	probably damaging	Het
Fer1l4	A	G	2: 156,029,685	F1392L	probably benign	Het
Fstl4	T	C	11: 53,168,178	I488T	possibly damaging	Het
Gak	A	T	5: 108,604,377	Y338*	probably null	Het
Glp2r	T	C	11: 67,757,541	T112A	probably benign	Het
Glrb	G	A	3: 80,861,774	T180I	probably damaging	Het
Gm10118	C	T	10: 63,926,892		probably benign	Het
Gpr19	A	T	6: 134,870,229	F72I	possibly damaging	Het
Grin3b	C	A	10: 79,975,882	N740K	probably damaging	Het
Gstk1	A	T	6: 42,246,601	T42S	probably benign	Het
Hoxd1	G	A	2: 74,764,282	A294T	probably benign	Het
Ift74	A	T	4: 94,685,703	N472I	probably benign	Het
Il1a	C	T	2: 129,302,893	D202N	probably damaging	Het
Islr	T	C	9: 58,157,495	D243G	probably damaging	Het
Kif21a	C	T	15: 90,959,743	E1098K	probably damaging	Het
Krtap16-1	T	C	11: 99,986,026	E184G	probably damaging	Het
Lrp1b	A	G	2: 41,185,962	I1889T	possibly damaging	Het
Mcpt4	A	G	14: 56,059,959	*247Q	probably null	Het
Megf10	T	C	18: 57,277,730		probably null	Het
Mettl2	T	A	11: 105,139,718	H373Q	probably benign	Het
Mocos	A	G	18: 24,683,216	K617E	probably damaging	Het
Ms4a8a	A	G	19: 11,076,397	I115T	probably damaging	Het
Ndst1	T	C	18: 60,695,508	Y658C	probably damaging	Het
Nin	G	A	12: 70,030,938	A1031V	probably benign	Het
Nin	C	A	12: 70,045,563	K657N	possibly damaging	Het
Noc4l	G	A	5: 110,649,847	R344*	probably null	Het
Notch2	T	C	3: 98,145,127	S1980P	probably damaging	Het
Npat	C	T	9: 53,562,660	S584L	probably benign	Het
Nphp4	A	G	4: 152,496,664	T102A	probably damaging	Het
Olfml2b	A	G	1: 170,645,073	N51S	possibly damaging	Het
Olfr1042	T	C	2: 86,159,936	I145V	probably benign	Het
Olfr138	A	G	17: 38,275,041	K90R	probably benign	Het
Olfr1388	T	A	11: 49,444,289	I146N	possibly damaging	Het
Olfr153	A	G	2: 87,532,083	T17A	probably benign	Het
Pced1b	T	A	15: 97,384,877	W266R	probably damaging	Het
Pdcd6ip	A	G	9: 113,678,354	V378A	probably damaging	Het
Pde8b	T	A	13: 95,032,866	K683N	probably damaging	Het
Pfas	T	G	11: 68,998,046		probably null	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Plcd4	T	G	1: 74,548,235	S51R	probably benign	Het
Plekhh2	T	A	17: 84,577,184	Y775*	probably null	Het
Polr3a	G	A	14: 24,484,164	P91L	probably damaging	Het
Ppp4r3b	C	T	11: 29,213,765	T47I	possibly damaging	Het
Pter	A	T	2: 12,994,761	D169V	probably damaging	Het
Ptpn12	A	G	5: 20,998,170	S537P	probably benign	Het
Ptpru	T	A	4: 131,779,050	D1067V	probably damaging	Het
Rcn1	A	T	2: 105,399,005	D67E	probably damaging	Het
Rfc4	T	C	16: 23,114,233	E318G	probably benign	Het
Samd13	C	A	3: 146,662,714	R41L	probably benign	Het
Slc6a2	T	C	8: 92,972,812	I156T	possibly damaging	Het
Spag16	T	C	1: 69,996,856	F348L	probably benign	Het
Spag4	T	C	2: 156,065,422	Y21H	probably damaging	Het
Stam2	G	A	2: 52,703,175	A368V	possibly damaging	Het
Stc1	A	T	14: 69,038,327	M190L	probably benign	Het
Stxbp1	A	G	2: 32,800,617	L475P	probably damaging	Het
Syn3	A	T	10: 86,080,211	Y304N	probably damaging	Het
Tbc1d15	G	T	10: 115,220,314	T251K	probably benign	Het
Tbpl2	A	T	2: 24,095,045	M29K	probably benign	Het
Tead3	T	G	17: 28,334,724	Q170H	possibly damaging	Het
Tpbpb	T	C	13: 60,902,163	N51D	probably benign	Het
Tstd3	A	G	4: 21,759,400	M124T	probably benign	Het
Ttyh1	T	A	7: 4,119,696	H14Q	possibly damaging	Het
Tubgcp4	G	A	2: 121,189,893	W449*	probably null	Het
Txndc11	A	G	16: 11,087,775		probably null	Het
Usp24	T	A	4: 106,438,827	D2615E	probably damaging	Het
Vars	A	G	17: 35,014,758	E1020G	possibly damaging	Het
Vmn2r58	A	G	7: 41,860,527	I542T	probably benign	Het
Vwf	A	G	6: 125,643,069	Y1570C	probably damaging	Het
Vwf	A	T	6: 125,685,900	Y2749F	possibly damaging	Het
Zfand1	A	C	3: 10,341,055	V198G	possibly damaging	Het
Zfp536	G	A	7: 37,569,454	T179I	probably damaging	Het
Zfp599	T	C	9: 22,250,404	Y155C	probably benign	Het

Other mutations in Hspg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Hspg2	APN	4	137528820	missense	probably damaging	1.00
IGL00339:Hspg2	APN	4	137539195	missense	probably damaging	1.00
IGL00943:Hspg2	APN	4	137562201	missense	probably benign	0.15
IGL00970:Hspg2	APN	4	137542590	missense	probably benign	0.09
IGL01011:Hspg2	APN	4	137559335	missense	probably damaging	1.00
IGL01148:Hspg2	APN	4	137546658	missense	probably benign	0.11
IGL01333:Hspg2	APN	4	137540314	missense	probably damaging	1.00
IGL01367:Hspg2	APN	4	137538489	missense	probably damaging	1.00
IGL01455:Hspg2	APN	4	137553817	missense	probably damaging	1.00
IGL01540:Hspg2	APN	4	137519706	missense	probably damaging	1.00
IGL01578:Hspg2	APN	4	137539183	missense	probably damaging	1.00
IGL01603:Hspg2	APN	4	137552803	missense	probably damaging	1.00
IGL01632:Hspg2	APN	4	137514773	missense	probably damaging	1.00
IGL01658:Hspg2	APN	4	137564926	missense	probably damaging	1.00
IGL01760:Hspg2	APN	4	137512671	missense	possibly damaging	0.60
IGL01976:Hspg2	APN	4	137561926	missense	probably damaging	1.00
IGL02024:Hspg2	APN	4	137540073	missense	probably damaging	1.00
IGL02033:Hspg2	APN	4	137552254	missense	probably benign
IGL02051:Hspg2	APN	4	137568389	unclassified	probably benign
IGL02124:Hspg2	APN	4	137518814	splice site	probably null
IGL02128:Hspg2	APN	4	137564016	missense	probably damaging	1.00
IGL02177:Hspg2	APN	4	137515316	missense	probably damaging	1.00
IGL02230:Hspg2	APN	4	137518645	missense	probably damaging	1.00
IGL02266:Hspg2	APN	4	137510577	missense	probably damaging	1.00
IGL02313:Hspg2	APN	4	137508389	missense	probably benign	0.03
IGL02477:Hspg2	APN	4	137544512	splice site	probably benign
IGL02514:Hspg2	APN	4	137569576	missense	probably benign	0.09
IGL02613:Hspg2	APN	4	137544420	missense	probably damaging	1.00
IGL02625:Hspg2	APN	4	137512642	missense	probably damaging	1.00
IGL02646:Hspg2	APN	4	137551848	missense	possibly damaging	0.60
IGL02651:Hspg2	APN	4	137557445	splice site	probably benign
IGL02701:Hspg2	APN	4	137557174	missense	probably damaging	0.96
IGL02833:Hspg2	APN	4	137555130	missense	probably benign	0.00
IGL02985:Hspg2	APN	4	137507803	missense	probably damaging	1.00
IGL03040:Hspg2	APN	4	137561825	critical splice donor site	probably null
IGL03181:Hspg2	APN	4	137515937	missense	probably damaging	1.00
IGL03349:Hspg2	APN	4	137560522	splice site	probably benign
G1patch:Hspg2	UTSW	4	137515307	missense	probably damaging	1.00
PIT4305001:Hspg2	UTSW	4	137550373	missense	possibly damaging	0.55
R0006:Hspg2	UTSW	4	137519931	missense	probably damaging	1.00
R0036:Hspg2	UTSW	4	137542849	missense	probably damaging	1.00
R0109:Hspg2	UTSW	4	137562201	missense	probably benign	0.15
R0131:Hspg2	UTSW	4	137551887	missense	probably damaging	1.00
R0131:Hspg2	UTSW	4	137551887	missense	probably damaging	1.00
R0132:Hspg2	UTSW	4	137551887	missense	probably damaging	1.00
R0245:Hspg2	UTSW	4	137514722	missense	probably damaging	1.00
R0388:Hspg2	UTSW	4	137511158	missense	probably damaging	1.00
R0389:Hspg2	UTSW	4	137515423	missense	possibly damaging	0.53
R0468:Hspg2	UTSW	4	137533529	missense	probably damaging	1.00
R0480:Hspg2	UTSW	4	137550024	missense	probably damaging	1.00
R0546:Hspg2	UTSW	4	137502294	missense	probably benign
R0599:Hspg2	UTSW	4	137512401	missense	probably damaging	0.98
R0652:Hspg2	UTSW	4	137514722	missense	probably damaging	1.00
R0671:Hspg2	UTSW	4	137553280	missense	probably damaging	1.00
R0760:Hspg2	UTSW	4	137512349	missense	probably damaging	1.00
R0883:Hspg2	UTSW	4	137541440	missense	probably benign	0.00
R1403:Hspg2	UTSW	4	137540100	missense	possibly damaging	0.90
R1417:Hspg2	UTSW	4	137517636	missense	probably benign
R1497:Hspg2	UTSW	4	137548096	missense	probably damaging	0.98
R1509:Hspg2	UTSW	4	137511241	splice site	probably benign
R1625:Hspg2	UTSW	4	137518971	missense	probably benign	0.23
R1630:Hspg2	UTSW	4	137518435	missense	probably damaging	1.00
R1651:Hspg2	UTSW	4	137533437	nonsense	probably null
R1703:Hspg2	UTSW	4	137559151	missense	probably damaging	1.00
R1761:Hspg2	UTSW	4	137514673	missense	possibly damaging	0.90
R1775:Hspg2	UTSW	4	137520156	missense	probably damaging	0.99
R1779:Hspg2	UTSW	4	137518509	missense	probably damaging	1.00
R1843:Hspg2	UTSW	4	137545567	missense	probably damaging	1.00
R1891:Hspg2	UTSW	4	137565490	missense	probably damaging	1.00
R1930:Hspg2	UTSW	4	137540230	missense	probably damaging	1.00
R1931:Hspg2	UTSW	4	137540230	missense	probably damaging	1.00
R1942:Hspg2	UTSW	4	137542552	missense	possibly damaging	0.67
R1959:Hspg2	UTSW	4	137564895	missense	probably damaging	1.00
R2042:Hspg2	UTSW	4	137568366	missense	probably damaging	1.00
R2062:Hspg2	UTSW	4	137559367	missense	possibly damaging	0.79
R2098:Hspg2	UTSW	4	137520109	missense	probably damaging	1.00
R2158:Hspg2	UTSW	4	137517604	missense	probably damaging	1.00
R2280:Hspg2	UTSW	4	137522043	missense	probably damaging	1.00
R2890:Hspg2	UTSW	4	137549574	missense	probably damaging	1.00
R2927:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R3428:Hspg2	UTSW	4	137555290	missense	probably damaging	1.00
R3744:Hspg2	UTSW	4	137565504	splice site	probably benign
R3873:Hspg2	UTSW	4	137539349	missense	probably damaging	1.00
R3874:Hspg2	UTSW	4	137539349	missense	probably damaging	1.00
R3917:Hspg2	UTSW	4	137559314	missense	probably damaging	1.00
R3932:Hspg2	UTSW	4	137515568	missense	probably damaging	0.99
R3933:Hspg2	UTSW	4	137515568	missense	probably damaging	0.99
R4134:Hspg2	UTSW	4	137556657	missense	probably damaging	0.99
R4272:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4273:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4274:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4275:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4288:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4289:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4354:Hspg2	UTSW	4	137468911	missense	probably benign	0.17
R4355:Hspg2	UTSW	4	137529418	missense	probably damaging	0.98
R4400:Hspg2	UTSW	4	137548122	missense	probably benign	0.01
R4411:Hspg2	UTSW	4	137562224	missense	probably benign
R4421:Hspg2	UTSW	4	137548122	missense	probably benign	0.01
R4592:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4612:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4612:Hspg2	UTSW	4	137539575	missense	possibly damaging	0.80
R4619:Hspg2	UTSW	4	137546573	missense	probably damaging	1.00
R4658:Hspg2	UTSW	4	137533730	missense	probably damaging	1.00
R4667:Hspg2	UTSW	4	137539645	missense	possibly damaging	0.90
R4724:Hspg2	UTSW	4	137522127	missense	probably damaging	0.96
R4739:Hspg2	UTSW	4	137570073	unclassified	probably benign
R4793:Hspg2	UTSW	4	137529473	missense	possibly damaging	0.95
R4826:Hspg2	UTSW	4	137565395	missense	probably damaging	1.00
R4838:Hspg2	UTSW	4	137541666	missense	possibly damaging	0.53
R4896:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4926:Hspg2	UTSW	4	137542530	missense	probably damaging	1.00
R4939:Hspg2	UTSW	4	137508031	missense	probably damaging	1.00
R5032:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R5033:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R5071:Hspg2	UTSW	4	137540230	missense	probably damaging	1.00
R5072:Hspg2	UTSW	4	137540230	missense	probably damaging	1.00
R5114:Hspg2	UTSW	4	137511926	missense	probably damaging	1.00
R5177:Hspg2	UTSW	4	137518772	missense	probably damaging	1.00
R5223:Hspg2	UTSW	4	137543914	missense	probably damaging	1.00
R5433:Hspg2	UTSW	4	137528794	splice site	probably null
R5529:Hspg2	UTSW	4	137551828	missense	probably damaging	1.00
R5541:Hspg2	UTSW	4	137520551	missense	probably damaging	1.00
R5541:Hspg2	UTSW	4	137542825	missense	probably benign	0.17
R5546:Hspg2	UTSW	4	137548174	critical splice donor site	probably null
R5728:Hspg2	UTSW	4	137542766	missense	possibly damaging	0.95
R5764:Hspg2	UTSW	4	137561721	missense	probably damaging	1.00
R5920:Hspg2	UTSW	4	137553782	missense	probably damaging	1.00
R5934:Hspg2	UTSW	4	137518772	missense	probably damaging	1.00
R6074:Hspg2	UTSW	4	137540735	missense	probably benign
R6164:Hspg2	UTSW	4	137514655	missense	possibly damaging	0.89
R6175:Hspg2	UTSW	4	137569518	missense	probably damaging	1.00
R6217:Hspg2	UTSW	4	137540248	missense	probably damaging	0.99
R6262:Hspg2	UTSW	4	137519686	missense	probably damaging	1.00
R6299:Hspg2	UTSW	4	137544705	missense	probably damaging	1.00
R6333:Hspg2	UTSW	4	137561955	missense	probably damaging	1.00
R6371:Hspg2	UTSW	4	137541695	missense	probably damaging	1.00
R6430:Hspg2	UTSW	4	137539396	missense	probably damaging	1.00
R6498:Hspg2	UTSW	4	137507801	missense	possibly damaging	0.46
R6522:Hspg2	UTSW	4	137555275	missense	probably damaging	1.00
R6680:Hspg2	UTSW	4	137565737	missense	probably benign	0.18
R6724:Hspg2	UTSW	4	137515307	missense	probably damaging	1.00
R6725:Hspg2	UTSW	4	137515307	missense	probably damaging	1.00
R6762:Hspg2	UTSW	4	137551803	missense	possibly damaging	0.83
R6785:Hspg2	UTSW	4	137508398	missense	probably damaging	0.99
R6788:Hspg2	UTSW	4	137515307	missense	probably damaging	1.00
R6931:Hspg2	UTSW	4	137540720	missense	probably damaging	1.00
R6959:Hspg2	UTSW	4	137519289	missense	probably benign	0.45
R6968:Hspg2	UTSW	4	137535156	missense	probably damaging	1.00
R6988:Hspg2	UTSW	4	137528890	missense	probably damaging	1.00
R7021:Hspg2	UTSW	4	137542269	missense	possibly damaging	0.69
R7089:Hspg2	UTSW	4	137544366	missense	possibly damaging	0.51
R7107:Hspg2	UTSW	4	137510652	missense	probably damaging	1.00
R7141:Hspg2	UTSW	4	137552116	missense	probably damaging	1.00
R7161:Hspg2	UTSW	4	137514719	missense	probably damaging	1.00
R7189:Hspg2	UTSW	4	137533561	critical splice donor site	probably null
R7238:Hspg2	UTSW	4	137508393	missense	probably damaging	1.00
R7253:Hspg2	UTSW	4	137519946	missense	probably benign	0.15
R7278:Hspg2	UTSW	4	137551125	missense	probably damaging	0.98
R7287:Hspg2	UTSW	4	137529556	missense	probably benign	0.00
R7390:Hspg2	UTSW	4	137539179	missense	probably damaging	1.00
R7436:Hspg2	UTSW	4	137515664	missense	probably damaging	0.99
R7479:Hspg2	UTSW	4	137539403	missense	probably benign	0.17
R7516:Hspg2	UTSW	4	137542620	missense	possibly damaging	0.94
R7540:Hspg2	UTSW	4	137541440	missense	possibly damaging	0.51
R7603:Hspg2	UTSW	4	137548368	missense	probably damaging	1.00
R7603:Hspg2	UTSW	4	137557192	missense	possibly damaging	0.91
R7625:Hspg2	UTSW	4	137564938	missense	probably damaging	1.00
R7696:Hspg2	UTSW	4	137511966	missense	possibly damaging	0.78
R7767:Hspg2	UTSW	4	137511866	missense	probably damaging	1.00
R7815:Hspg2	UTSW	4	137512464	missense	probably damaging	1.00
R7825:Hspg2	UTSW	4	137558849	missense	probably damaging	1.00
R7863:Hspg2	UTSW	4	137564824	missense	probably benign	0.03
R7885:Hspg2	UTSW	4	137516837	missense	probably damaging	1.00
R7899:Hspg2	UTSW	4	137548116	missense	possibly damaging	0.72
R7937:Hspg2	UTSW	4	137550932	missense	probably benign	0.01
R7975:Hspg2	UTSW	4	137555221	missense	probably benign	0.26
R8078:Hspg2	UTSW	4	137508022	missense	probably damaging	1.00
R8285:Hspg2	UTSW	4	137512663	missense	probably benign	0.18
R8314:Hspg2	UTSW	4	137539675	missense	probably benign	0.12
R8322:Hspg2	UTSW	4	137518979	missense	possibly damaging	0.88
R8323:Hspg2	UTSW	4	137518979	missense	possibly damaging	0.88
R8324:Hspg2	UTSW	4	137518979	missense	possibly damaging	0.88
R8341:Hspg2	UTSW	4	137518979	missense	possibly damaging	0.88
R8383:Hspg2	UTSW	4	137544370	missense	possibly damaging	0.66
R8425:Hspg2	UTSW	4	137550867	nonsense	probably null
R8491:Hspg2	UTSW	4	137553719	missense	probably benign	0.00
R8525:Hspg2	UTSW	4	137539448	missense	probably damaging	0.98
R8978:Hspg2	UTSW	4	137564030	missense	probably benign	0.09
R9152:Hspg2	UTSW	4	137522565	missense	possibly damaging	0.89
R9166:Hspg2	UTSW	4	137542874	missense	probably damaging	1.00
R9175:Hspg2	UTSW	4	137529346	missense	probably damaging	0.98
R9210:Hspg2	UTSW	4	137562479	missense	probably benign	0.05
R9221:Hspg2	UTSW	4	137560415	missense	possibly damaging	0.79
R9325:Hspg2	UTSW	4	137538241	missense	probably damaging	1.00
R9339:Hspg2	UTSW	4	137551169	missense	probably benign
R9340:Hspg2	UTSW	4	137569516	missense	probably damaging	1.00
R9358:Hspg2	UTSW	4	137517598	missense	probably damaging	1.00
R9451:Hspg2	UTSW	4	137511069	missense	probably damaging	1.00
R9534:Hspg2	UTSW	4	137540761	missense	probably benign
R9656:Hspg2	UTSW	4	137551885	missense	probably benign
R9664:Hspg2	UTSW	4	137539576	missense	probably benign	0.03
R9695:Hspg2	UTSW	4	137538390	missense	probably damaging	1.00
R9741:Hspg2	UTSW	4	137512651	missense	probably damaging	1.00
V5622:Hspg2	UTSW	4	137533738	missense	probably damaging	0.99
V5622:Hspg2	UTSW	4	137533738	missense	probably damaging	0.99
X0028:Hspg2	UTSW	4	137550391	missense	probably benign
Z1177:Hspg2	UTSW	4	137550467	missense	probably damaging	1.00
Z1177:Hspg2	UTSW	4	137564518	missense	probably damaging	0.99
Z1177:Hspg2	UTSW	4	137568373	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- TCAAGGATGTGGGACCTTAGAGCAG -3'
(R):5'- TAAGATGTCAGGCAAGAGCCTCGG -3'

Sequencing Primer
(F):5'- gagcagagcctagctcac -3'
(R):5'- AGCTTCCCAGACAGGTACG -3'

Posted On

2014-05-14