Mutagenetix > Incidental Mutations

Incidental Mutation 'R1699:Ptpn12'

192499

Institutional Source

Beutler Lab

Gene Symbol

Ptpn12

Ensembl Gene

ENSMUSG00000028771

Gene Name

protein tyrosine phosphatase, non-receptor type 12

Synonyms

P19-PTP, PTP-PEST, PTP-P19

MMRRC Submission

039732-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1699 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20986645-21055911 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20998170 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 537 (S537P)

Ref Sequence

ENSEMBL: ENSMUSP00000030556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030556] [ENSMUST00000151813]

Predicted Effect

probably benign
Transcript: ENSMUST00000030556
AA Change: S537P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000030556
Gene: ENSMUSG00000028771
AA Change: S537P

Domain	Start	End	E-Value	Type
PTPc	27	295	2.14e-126	SMART
Blast:PTPc	338	399	7e-12	BLAST
low complexity region	499	518	N/A	INTRINSIC
low complexity region	603	615	N/A	INTRINSIC
low complexity region	622	640	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126853

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148711

Predicted Effect

probably benign
Transcript: ENSMUST00000151813

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains a C-terminal PEST motif, which serves as a protein-protein interaction domain, and may regulate protein intracellular half-life. This PTP was found to bind and dephosphorylate the product of the oncogene c-ABL and thus may play a role in oncogenesis. This PTP was also shown to interact with, and dephosphorylate, various products related to cytoskeletal structure and cell adhesion, such as p130 (Cas), CAKbeta/PTK2B, PSTPIP1, and paxillin. This suggests it has a regulatory role in controlling cell shape and mobility. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality, defective embryo turning, improper somitogenesis and vasculogenesis, impaired liver development, truncation of the caudal region and mesenchyme deficiency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C02Rik	A	G	5: 30,483,866		probably null	Het
Abca2	A	G	2: 25,447,351	E2406G	possibly damaging	Het
Adam6b	T	A	12: 113,490,585	F341I	probably benign	Het
Adam8	A	T	7: 139,983,311	N767K	possibly damaging	Het
AI481877	T	C	4: 59,113,926	K13R	unknown	Het
Aig1	T	C	10: 13,868,622	D46G	possibly damaging	Het
Alms1	A	G	6: 85,622,880	I2032V	possibly damaging	Het
Ankrd16	A	G	2: 11,784,393	I264V	probably benign	Het
Areg	T	G	5: 91,143,498	V100G	probably damaging	Het
Bcan	A	G	3: 87,989,236	Y718H	probably damaging	Het
Brsk2	T	A	7: 141,985,463	I188N	probably damaging	Het
Ccdc189	A	T	7: 127,586,856		probably null	Het
Cdt1	T	C	8: 122,569,983	Y203H	probably damaging	Het
Chil3	A	C	3: 106,160,366		probably null	Het
Cth	A	G	3: 157,907,436	L253P	probably damaging	Het
Cyp11b1	A	G	15: 74,840,817	F132L	possibly damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dnah11	A	G	12: 118,190,868	S226P	probably damaging	Het
Egfr	A	T	11: 16,859,019	Q71L	probably benign	Het
Eml6	T	A	11: 29,746,282	K1940*	probably null	Het
Epn2	T	A	11: 61,523,188	K391*	probably null	Het
Erich1	A	T	8: 14,090,259	S2T	possibly damaging	Het
Evi5	A	C	5: 107,818,920	L245R	probably damaging	Het
Evpl	T	C	11: 116,227,588	Y731C	probably damaging	Het
Exoc3l	G	A	8: 105,295,013	H128Y	probably benign	Het
Extl1	G	A	4: 134,364,583	Q320*	probably null	Het
Fam71a	T	A	1: 191,163,821	E208D	probably benign	Het
Fam91a1	T	A	15: 58,432,948	S416T	probably benign	Het
Fam96b	A	G	8: 104,640,086	V132A	probably damaging	Het
Fat3	A	T	9: 15,938,398	S3903T	probably damaging	Het
Fer1l4	A	G	2: 156,029,685	F1392L	probably benign	Het
Fstl4	T	C	11: 53,168,178	I488T	possibly damaging	Het
Gak	A	T	5: 108,604,377	Y338*	probably null	Het
Glp2r	T	C	11: 67,757,541	T112A	probably benign	Het
Glrb	G	A	3: 80,861,774	T180I	probably damaging	Het
Gm10118	C	T	10: 63,926,892		probably benign	Het
Gpr19	A	T	6: 134,870,229	F72I	possibly damaging	Het
Grin3b	C	A	10: 79,975,882	N740K	probably damaging	Het
Gstk1	A	T	6: 42,246,601	T42S	probably benign	Het
Hoxd1	G	A	2: 74,764,282	A294T	probably benign	Het
Hspg2	T	A	4: 137,548,012		probably null	Het
Ift74	A	T	4: 94,685,703	N472I	probably benign	Het
Il1a	C	T	2: 129,302,893	D202N	probably damaging	Het
Islr	T	C	9: 58,157,495	D243G	probably damaging	Het
Kif21a	C	T	15: 90,959,743	E1098K	probably damaging	Het
Krtap16-1	T	C	11: 99,986,026	E184G	probably damaging	Het
Lrp1b	A	G	2: 41,185,962	I1889T	possibly damaging	Het
Mcpt4	A	G	14: 56,059,959	*247Q	probably null	Het
Megf10	T	C	18: 57,277,730		probably null	Het
Mettl2	T	A	11: 105,139,718	H373Q	probably benign	Het
Mocos	A	G	18: 24,683,216	K617E	probably damaging	Het
Ms4a8a	A	G	19: 11,076,397	I115T	probably damaging	Het
Ndst1	T	C	18: 60,695,508	Y658C	probably damaging	Het
Nin	G	A	12: 70,030,938	A1031V	probably benign	Het
Nin	C	A	12: 70,045,563	K657N	possibly damaging	Het
Noc4l	G	A	5: 110,649,847	R344*	probably null	Het
Notch2	T	C	3: 98,145,127	S1980P	probably damaging	Het
Npat	C	T	9: 53,562,660	S584L	probably benign	Het
Nphp4	A	G	4: 152,496,664	T102A	probably damaging	Het
Olfml2b	A	G	1: 170,645,073	N51S	possibly damaging	Het
Olfr1042	T	C	2: 86,159,936	I145V	probably benign	Het
Olfr138	A	G	17: 38,275,041	K90R	probably benign	Het
Olfr1388	T	A	11: 49,444,289	I146N	possibly damaging	Het
Olfr153	A	G	2: 87,532,083	T17A	probably benign	Het
Pced1b	T	A	15: 97,384,877	W266R	probably damaging	Het
Pdcd6ip	A	G	9: 113,678,354	V378A	probably damaging	Het
Pde8b	T	A	13: 95,032,866	K683N	probably damaging	Het
Pfas	T	G	11: 68,998,046		probably null	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Plcd4	T	G	1: 74,548,235	S51R	probably benign	Het
Plekhh2	T	A	17: 84,577,184	Y775*	probably null	Het
Polr3a	G	A	14: 24,484,164	P91L	probably damaging	Het
Ppp4r3b	C	T	11: 29,213,765	T47I	possibly damaging	Het
Pter	A	T	2: 12,994,761	D169V	probably damaging	Het
Ptpru	T	A	4: 131,779,050	D1067V	probably damaging	Het
Rcn1	A	T	2: 105,399,005	D67E	probably damaging	Het
Rfc4	T	C	16: 23,114,233	E318G	probably benign	Het
Samd13	C	A	3: 146,662,714	R41L	probably benign	Het
Slc6a2	T	C	8: 92,972,812	I156T	possibly damaging	Het
Spag16	T	C	1: 69,996,856	F348L	probably benign	Het
Spag4	T	C	2: 156,065,422	Y21H	probably damaging	Het
Stam2	G	A	2: 52,703,175	A368V	possibly damaging	Het
Stc1	A	T	14: 69,038,327	M190L	probably benign	Het
Stxbp1	A	G	2: 32,800,617	L475P	probably damaging	Het
Syn3	A	T	10: 86,080,211	Y304N	probably damaging	Het
Tbc1d15	G	T	10: 115,220,314	T251K	probably benign	Het
Tbpl2	A	T	2: 24,095,045	M29K	probably benign	Het
Tead3	T	G	17: 28,334,724	Q170H	possibly damaging	Het
Tpbpb	T	C	13: 60,902,163	N51D	probably benign	Het
Tstd3	A	G	4: 21,759,400	M124T	probably benign	Het
Ttyh1	T	A	7: 4,119,696	H14Q	possibly damaging	Het
Tubgcp4	G	A	2: 121,189,893	W449*	probably null	Het
Txndc11	A	G	16: 11,087,775		probably null	Het
Usp24	T	A	4: 106,438,827	D2615E	probably damaging	Het
Vars	A	G	17: 35,014,758	E1020G	possibly damaging	Het
Vmn2r58	A	G	7: 41,860,527	I542T	probably benign	Het
Vwf	A	G	6: 125,643,069	Y1570C	probably damaging	Het
Vwf	A	T	6: 125,685,900	Y2749F	possibly damaging	Het
Zfand1	A	C	3: 10,341,055	V198G	possibly damaging	Het
Zfp536	G	A	7: 37,569,454	T179I	probably damaging	Het
Zfp599	T	C	9: 22,250,404	Y155C	probably benign	Het

Other mutations in Ptpn12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Ptpn12	APN	5	21029850	missense	probably damaging	1.00
IGL00226:Ptpn12	APN	5	20998668	missense	probably damaging	1.00
IGL01432:Ptpn12	APN	5	20998555	nonsense	probably null
IGL02285:Ptpn12	APN	5	21055713	missense	probably benign	0.40
IGL02488:Ptpn12	APN	5	21022062	missense	possibly damaging	0.72
IGL02550:Ptpn12	APN	5	20998139	missense	probably benign	0.00
IGL02640:Ptpn12	APN	5	21019246	missense	probably damaging	1.00
IGL02652:Ptpn12	APN	5	21002437	missense	probably benign	0.04
IGL03130:Ptpn12	APN	5	21002612	unclassified	probably benign
R0531:Ptpn12	UTSW	5	20998483	missense	possibly damaging	0.53
R0948:Ptpn12	UTSW	5	20998043	missense	probably benign
R1018:Ptpn12	UTSW	5	21029869	missense	possibly damaging	0.94
R1184:Ptpn12	UTSW	5	20998356	missense	possibly damaging	0.86
R1938:Ptpn12	UTSW	5	20993263	missense	probably damaging	1.00
R1952:Ptpn12	UTSW	5	20998310	missense	probably benign	0.34
R2152:Ptpn12	UTSW	5	21002468	missense	probably damaging	1.00
R2153:Ptpn12	UTSW	5	21002468	missense	probably damaging	1.00
R2154:Ptpn12	UTSW	5	21002468	missense	probably damaging	1.00
R2267:Ptpn12	UTSW	5	20998411	missense	probably damaging	0.98
R2358:Ptpn12	UTSW	5	20998692	missense	probably damaging	1.00
R3551:Ptpn12	UTSW	5	20989049	missense	possibly damaging	0.67
R3931:Ptpn12	UTSW	5	21001323	missense	probably benign	0.00
R4013:Ptpn12	UTSW	5	20992743	missense	probably benign	0.05
R4039:Ptpn12	UTSW	5	21002510	nonsense	probably null
R4501:Ptpn12	UTSW	5	21019280	missense	probably damaging	1.00
R4748:Ptpn12	UTSW	5	21005385	nonsense	probably null
R4754:Ptpn12	UTSW	5	20998589	missense	probably benign	0.34
R4963:Ptpn12	UTSW	5	21015708	splice site	probably null
R5160:Ptpn12	UTSW	5	20997831	missense	probably damaging	1.00
R5581:Ptpn12	UTSW	5	21015726	missense	probably damaging	1.00
R5789:Ptpn12	UTSW	5	20989015	missense	possibly damaging	0.92
R5836:Ptpn12	UTSW	5	21009546	nonsense	probably null
R6383:Ptpn12	UTSW	5	20987468	nonsense	probably null
R6883:Ptpn12	UTSW	5	21055713	missense	probably benign	0.40
R7544:Ptpn12	UTSW	5	21009511	missense	probably damaging	1.00
R7885:Ptpn12	UTSW	5	20998525	missense	possibly damaging	0.54
R7915:Ptpn12	UTSW	5	21009451	missense	probably damaging	1.00
R7960:Ptpn12	UTSW	5	21055689	missense	probably benign	0.01
R7976:Ptpn12	UTSW	5	21002633	nonsense	probably null
R8032:Ptpn12	UTSW	5	20998043	missense	probably benign
R8224:Ptpn12	UTSW	5	20998658	missense	probably damaging	1.00
X0004:Ptpn12	UTSW	5	21019296	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCTGGTCACAGCACCATCAGAG -3'
(R):5'- GGAGTTAAGTGCAGGTGCCCTAAAG -3'

Sequencing Primer
(F):5'- TCTGAGTCCGAGTCGTCAGAG -3'
(R):5'- CAGGTGCCCTAAAGGTTGATG -3'

Posted On

2014-05-14