Mutagenetix > Incidental Mutation

Incidental Mutation 'R1699:Alms1'

192508

Institutional Source

Beutler Lab

Gene Symbol

Alms1

Ensembl Gene

ENSMUSG00000063810

Gene Name

ALMS1, centrosome and basal body associated

Synonyms

MMRRC Submission

039732-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1699 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85587531-85702753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85622880 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 2032 (I2032V)

Ref Sequence

ENSEMBL: ENSMUSP00000148796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000213058]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000072018
AA Change: I1563V

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: I1563V

Domain	Start	End	E-Value	Type
coiled coil region	10	39	N/A	INTRINSIC
low complexity region	67	80	N/A	INTRINSIC
low complexity region	98	119	N/A	INTRINSIC
Blast:MYSc	127	233	1e-21	BLAST
internal_repeat_3	408	511	2.48e-7	PROSPERO
internal_repeat_2	414	804	2.09e-12	PROSPERO
internal_repeat_1	438	834	4.54e-18	PROSPERO
internal_repeat_3	652	757	2.48e-7	PROSPERO
low complexity region	903	908	N/A	INTRINSIC
internal_repeat_1	916	1385	4.54e-18	PROSPERO
internal_repeat_2	1024	1390	2.09e-12	PROSPERO
low complexity region	1572	1586	N/A	INTRINSIC
low complexity region	2004	2017	N/A	INTRINSIC
low complexity region	2760	2773	N/A	INTRINSIC
low complexity region	2950	2968	N/A	INTRINSIC
low complexity region	3013	3030	N/A	INTRINSIC
Pfam:ALMS_motif	3125	3247	1.8e-42	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213058
AA Change: I2032V

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C02Rik	A	G	5: 30,483,866		probably null	Het
Abca2	A	G	2: 25,447,351	E2406G	possibly damaging	Het
Adam6b	T	A	12: 113,490,585	F341I	probably benign	Het
Adam8	A	T	7: 139,983,311	N767K	possibly damaging	Het
AI481877	T	C	4: 59,113,926	K13R	unknown	Het
Aig1	T	C	10: 13,868,622	D46G	possibly damaging	Het
Ankrd16	A	G	2: 11,784,393	I264V	probably benign	Het
Areg	T	G	5: 91,143,498	V100G	probably damaging	Het
Bcan	A	G	3: 87,989,236	Y718H	probably damaging	Het
Brsk2	T	A	7: 141,985,463	I188N	probably damaging	Het
Ccdc189	A	T	7: 127,586,856		probably null	Het
Cdt1	T	C	8: 122,569,983	Y203H	probably damaging	Het
Chil3	A	C	3: 106,160,366		probably null	Het
Cth	A	G	3: 157,907,436	L253P	probably damaging	Het
Cyp11b1	A	G	15: 74,840,817	F132L	possibly damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dnah11	A	G	12: 118,190,868	S226P	probably damaging	Het
Egfr	A	T	11: 16,859,019	Q71L	probably benign	Het
Eml6	T	A	11: 29,746,282	K1940*	probably null	Het
Epn2	T	A	11: 61,523,188	K391*	probably null	Het
Erich1	A	T	8: 14,090,259	S2T	possibly damaging	Het
Evi5	A	C	5: 107,818,920	L245R	probably damaging	Het
Evpl	T	C	11: 116,227,588	Y731C	probably damaging	Het
Exoc3l	G	A	8: 105,295,013	H128Y	probably benign	Het
Extl1	G	A	4: 134,364,583	Q320*	probably null	Het
Fam71a	T	A	1: 191,163,821	E208D	probably benign	Het
Fam91a1	T	A	15: 58,432,948	S416T	probably benign	Het
Fam96b	A	G	8: 104,640,086	V132A	probably damaging	Het
Fat3	A	T	9: 15,938,398	S3903T	probably damaging	Het
Fer1l4	A	G	2: 156,029,685	F1392L	probably benign	Het
Fstl4	T	C	11: 53,168,178	I488T	possibly damaging	Het
Gak	A	T	5: 108,604,377	Y338*	probably null	Het
Glp2r	T	C	11: 67,757,541	T112A	probably benign	Het
Glrb	G	A	3: 80,861,774	T180I	probably damaging	Het
Gm10118	C	T	10: 63,926,892		probably benign	Het
Gpr19	A	T	6: 134,870,229	F72I	possibly damaging	Het
Grin3b	C	A	10: 79,975,882	N740K	probably damaging	Het
Gstk1	A	T	6: 42,246,601	T42S	probably benign	Het
Hoxd1	G	A	2: 74,764,282	A294T	probably benign	Het
Hspg2	T	A	4: 137,548,012		probably null	Het
Ift74	A	T	4: 94,685,703	N472I	probably benign	Het
Il1a	C	T	2: 129,302,893	D202N	probably damaging	Het
Islr	T	C	9: 58,157,495	D243G	probably damaging	Het
Kif21a	C	T	15: 90,959,743	E1098K	probably damaging	Het
Krtap16-1	T	C	11: 99,986,026	E184G	probably damaging	Het
Lrp1b	A	G	2: 41,185,962	I1889T	possibly damaging	Het
Mcpt4	A	G	14: 56,059,959	*247Q	probably null	Het
Megf10	T	C	18: 57,277,730		probably null	Het
Mettl2	T	A	11: 105,139,718	H373Q	probably benign	Het
Mocos	A	G	18: 24,683,216	K617E	probably damaging	Het
Ms4a8a	A	G	19: 11,076,397	I115T	probably damaging	Het
Ndst1	T	C	18: 60,695,508	Y658C	probably damaging	Het
Nin	G	A	12: 70,030,938	A1031V	probably benign	Het
Nin	C	A	12: 70,045,563	K657N	possibly damaging	Het
Noc4l	G	A	5: 110,649,847	R344*	probably null	Het
Notch2	T	C	3: 98,145,127	S1980P	probably damaging	Het
Npat	C	T	9: 53,562,660	S584L	probably benign	Het
Nphp4	A	G	4: 152,496,664	T102A	probably damaging	Het
Olfml2b	A	G	1: 170,645,073	N51S	possibly damaging	Het
Olfr1042	T	C	2: 86,159,936	I145V	probably benign	Het
Olfr138	A	G	17: 38,275,041	K90R	probably benign	Het
Olfr1388	T	A	11: 49,444,289	I146N	possibly damaging	Het
Olfr153	A	G	2: 87,532,083	T17A	probably benign	Het
Pced1b	T	A	15: 97,384,877	W266R	probably damaging	Het
Pdcd6ip	A	G	9: 113,678,354	V378A	probably damaging	Het
Pde8b	T	A	13: 95,032,866	K683N	probably damaging	Het
Pfas	T	G	11: 68,998,046		probably null	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Plcd4	T	G	1: 74,548,235	S51R	probably benign	Het
Plekhh2	T	A	17: 84,577,184	Y775*	probably null	Het
Polr3a	G	A	14: 24,484,164	P91L	probably damaging	Het
Ppp4r3b	C	T	11: 29,213,765	T47I	possibly damaging	Het
Pter	A	T	2: 12,994,761	D169V	probably damaging	Het
Ptpn12	A	G	5: 20,998,170	S537P	probably benign	Het
Ptpru	T	A	4: 131,779,050	D1067V	probably damaging	Het
Rcn1	A	T	2: 105,399,005	D67E	probably damaging	Het
Rfc4	T	C	16: 23,114,233	E318G	probably benign	Het
Samd13	C	A	3: 146,662,714	R41L	probably benign	Het
Slc6a2	T	C	8: 92,972,812	I156T	possibly damaging	Het
Spag16	T	C	1: 69,996,856	F348L	probably benign	Het
Spag4	T	C	2: 156,065,422	Y21H	probably damaging	Het
Stam2	G	A	2: 52,703,175	A368V	possibly damaging	Het
Stc1	A	T	14: 69,038,327	M190L	probably benign	Het
Stxbp1	A	G	2: 32,800,617	L475P	probably damaging	Het
Syn3	A	T	10: 86,080,211	Y304N	probably damaging	Het
Tbc1d15	G	T	10: 115,220,314	T251K	probably benign	Het
Tbpl2	A	T	2: 24,095,045	M29K	probably benign	Het
Tead3	T	G	17: 28,334,724	Q170H	possibly damaging	Het
Tpbpb	T	C	13: 60,902,163	N51D	probably benign	Het
Tstd3	A	G	4: 21,759,400	M124T	probably benign	Het
Ttyh1	T	A	7: 4,119,696	H14Q	possibly damaging	Het
Tubgcp4	G	A	2: 121,189,893	W449*	probably null	Het
Txndc11	A	G	16: 11,087,775		probably null	Het
Usp24	T	A	4: 106,438,827	D2615E	probably damaging	Het
Vars	A	G	17: 35,014,758	E1020G	possibly damaging	Het
Vmn2r58	A	G	7: 41,860,527	I542T	probably benign	Het
Vwf	A	G	6: 125,643,069	Y1570C	probably damaging	Het
Vwf	A	T	6: 125,685,900	Y2749F	possibly damaging	Het
Zfand1	A	C	3: 10,341,055	V198G	possibly damaging	Het
Zfp536	G	A	7: 37,569,454	T179I	probably damaging	Het
Zfp599	T	C	9: 22,250,404	Y155C	probably benign	Het

Other mutations in Alms1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Alms1	APN	6	85677964	missense	probably damaging	1.00
IGL00331:Alms1	APN	6	85641371	missense	possibly damaging	0.94
IGL00658:Alms1	APN	6	85628961	missense	probably damaging	1.00
IGL00835:Alms1	APN	6	85622134	missense	probably damaging	1.00
IGL00930:Alms1	APN	6	85601310	missense	probably damaging	0.98
IGL01446:Alms1	APN	6	85696701	missense	probably damaging	1.00
IGL01448:Alms1	APN	6	85677899	missense	possibly damaging	0.93
IGL01563:Alms1	APN	6	85627983	missense	probably damaging	1.00
IGL01632:Alms1	APN	6	85627946	missense	probably benign	0.07
IGL01651:Alms1	APN	6	85656476	missense	probably benign	0.05
IGL01670:Alms1	APN	6	85678150	missense	probably benign	0.00
IGL01716:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01719:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01720:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01723:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01877:Alms1	APN	6	85622411	missense	possibly damaging	0.55
IGL01919:Alms1	APN	6	85628004	missense	possibly damaging	0.77
IGL01976:Alms1	APN	6	85622665	missense	possibly damaging	0.73
IGL02003:Alms1	APN	6	85622223	missense	possibly damaging	0.54
IGL02069:Alms1	APN	6	85628823	missense	probably benign	0.12
IGL02070:Alms1	APN	6	85651403	missense	possibly damaging	0.74
IGL02079:Alms1	APN	6	85628634	missense	probably damaging	0.98
IGL02081:Alms1	APN	6	85620303	missense	possibly damaging	0.55
IGL02379:Alms1	APN	6	85629633	missense	probably damaging	0.98
IGL02412:Alms1	APN	6	85628872	missense	possibly damaging	0.91
IGL02606:Alms1	APN	6	85599967	missense	probably benign
IGL02636:Alms1	APN	6	85628654	missense	probably benign	0.28
IGL02702:Alms1	APN	6	85599849	missense	probably benign	0.12
IGL02815:Alms1	APN	6	85667957	critical splice donor site	probably null
IGL02926:Alms1	APN	6	85641450	missense	probably damaging	1.00
IGL02945:Alms1	APN	6	85620933	missense	probably damaging	0.96
IGL02959:Alms1	APN	6	85629052	nonsense	probably null
IGL03124:Alms1	APN	6	85678419	missense	probably benign	0.03
IGL03199:Alms1	APN	6	85622497	missense	possibly damaging	0.68
IGL03209:Alms1	APN	6	85599973	splice site	probably benign
IGL03247:Alms1	APN	6	85678597	missense	possibly damaging	0.85
ares	UTSW	6	85621275	nonsense	probably null
ares2	UTSW	6	85677990	nonsense	probably null
butterball	UTSW	6	85696771	missense	probably damaging	0.99
earthquake	UTSW	6	85628735	nonsense	probably null
fatty	UTSW	6	85627934	nonsense	probably null
gut_check	UTSW	6	85620369	nonsense	probably null
portly	UTSW	6	85619712	missense	probably benign	0.00
replete	UTSW	6	85629208	missense	possibly damaging	0.87
PIT4468001:Alms1	UTSW	6	85624719	critical splice donor site	probably null
R0003:Alms1	UTSW	6	85629210	missense	possibly damaging	0.90
R0095:Alms1	UTSW	6	85620253	missense	possibly damaging	0.90
R0110:Alms1	UTSW	6	85620369	nonsense	probably null
R0114:Alms1	UTSW	6	85619803	missense	probably benign	0.00
R0153:Alms1	UTSW	6	85641381	missense	possibly damaging	0.94
R0217:Alms1	UTSW	6	85622930	missense	probably damaging	0.99
R0328:Alms1	UTSW	6	85610814	splice site	probably null
R0410:Alms1	UTSW	6	85587803	missense	unknown
R0469:Alms1	UTSW	6	85620369	nonsense	probably null
R0491:Alms1	UTSW	6	85702600	missense	probably damaging	0.98
R0510:Alms1	UTSW	6	85620369	nonsense	probably null
R0522:Alms1	UTSW	6	85621615	missense	probably benign
R0525:Alms1	UTSW	6	85587760	missense	unknown
R0611:Alms1	UTSW	6	85678671	missense	possibly damaging	0.61
R0637:Alms1	UTSW	6	85623033	missense	possibly damaging	0.85
R0718:Alms1	UTSW	6	85621821	missense	probably benign	0.00
R0831:Alms1	UTSW	6	85628520	missense	probably benign	0.00
R1318:Alms1	UTSW	6	85628549	missense	possibly damaging	0.62
R1340:Alms1	UTSW	6	85667957	critical splice donor site	probably null
R1561:Alms1	UTSW	6	85629052	nonsense	probably null
R1648:Alms1	UTSW	6	85678402	missense	probably damaging	0.99
R1697:Alms1	UTSW	6	85622454	missense	possibly damaging	0.94
R1715:Alms1	UTSW	6	85629052	nonsense	probably null
R1723:Alms1	UTSW	6	85628753	missense	probably damaging	1.00
R1734:Alms1	UTSW	6	85641550	critical splice donor site	probably null
R1758:Alms1	UTSW	6	85628505	missense	probably damaging	0.99
R1804:Alms1	UTSW	6	85621275	nonsense	probably null
R1835:Alms1	UTSW	6	85678503	missense	possibly damaging	0.94
R1836:Alms1	UTSW	6	85678503	missense	possibly damaging	0.94
R2077:Alms1	UTSW	6	85622309	missense	possibly damaging	0.93
R2246:Alms1	UTSW	6	85622967	missense	possibly damaging	0.91
R2254:Alms1	UTSW	6	85619848	missense	probably damaging	1.00
R2280:Alms1	UTSW	6	85677973	missense	probably damaging	0.99
R2516:Alms1	UTSW	6	85667963	splice site	probably benign
R2519:Alms1	UTSW	6	85667963	splice site	probably benign
R2566:Alms1	UTSW	6	85622482	missense	possibly damaging	0.84
R2850:Alms1	UTSW	6	85621299	missense	probably benign	0.00
R2850:Alms1	UTSW	6	85667963	splice site	probably benign
R2932:Alms1	UTSW	6	85620562	missense	possibly damaging	0.89
R2944:Alms1	UTSW	6	85628391	missense	probably damaging	1.00
R2980:Alms1	UTSW	6	85628835	missense	probably damaging	1.00
R3084:Alms1	UTSW	6	85678140	missense	probably benign
R3086:Alms1	UTSW	6	85678140	missense	probably benign
R3122:Alms1	UTSW	6	85667963	splice site	probably benign
R3404:Alms1	UTSW	6	85667963	splice site	probably benign
R3405:Alms1	UTSW	6	85667963	splice site	probably benign
R3804:Alms1	UTSW	6	85619647	missense	probably damaging	1.00
R3904:Alms1	UTSW	6	85621678	missense	probably benign	0.00
R4014:Alms1	UTSW	6	85678352	missense	probably benign	0.41
R4056:Alms1	UTSW	6	85587803	missense	unknown
R4067:Alms1	UTSW	6	85621289	missense	probably damaging	1.00
R4110:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4111:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4112:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4194:Alms1	UTSW	6	85677990	nonsense	probably null
R4464:Alms1	UTSW	6	85620021	missense	possibly damaging	0.66
R4539:Alms1	UTSW	6	85620478	missense	possibly damaging	0.78
R4554:Alms1	UTSW	6	85624617	missense	probably benign
R4696:Alms1	UTSW	6	85620522	missense	probably damaging	1.00
R4825:Alms1	UTSW	6	85678245	missense	probably damaging	0.99
R4921:Alms1	UTSW	6	85628546	missense	probably benign	0.13
R5030:Alms1	UTSW	6	85627964	missense	probably damaging	0.98
R5051:Alms1	UTSW	6	85627934	nonsense	probably null
R5085:Alms1	UTSW	6	85620732	missense	possibly damaging	0.55
R5141:Alms1	UTSW	6	85621432	missense	probably benign	0.01
R5233:Alms1	UTSW	6	85656371	splice site	probably null
R5310:Alms1	UTSW	6	85615368	missense	possibly damaging	0.79
R5344:Alms1	UTSW	6	85696789	missense	probably benign	0.04
R5394:Alms1	UTSW	6	85623088	missense	probably benign	0.01
R5460:Alms1	UTSW	6	85696731	missense	probably benign	0.08
R5558:Alms1	UTSW	6	85641329	nonsense	probably null
R5650:Alms1	UTSW	6	85620271	missense	probably damaging	1.00
R5667:Alms1	UTSW	6	85696771	missense	probably damaging	0.99
R5671:Alms1	UTSW	6	85629208	missense	possibly damaging	0.87
R5688:Alms1	UTSW	6	85599895	missense	possibly damaging	0.92
R5815:Alms1	UTSW	6	85622838	missense	probably damaging	0.99
R5892:Alms1	UTSW	6	85620903	missense	probably damaging	0.99
R5947:Alms1	UTSW	6	85619712	missense	probably benign	0.00
R6031:Alms1	UTSW	6	85622955	missense	probably damaging	1.00
R6031:Alms1	UTSW	6	85622955	missense	probably damaging	1.00
R6144:Alms1	UTSW	6	85623074	missense	probably damaging	0.98
R6258:Alms1	UTSW	6	85628735	nonsense	probably null
R6260:Alms1	UTSW	6	85628735	nonsense	probably null
R6455:Alms1	UTSW	6	85696657	missense	probably damaging	0.99
R6569:Alms1	UTSW	6	85641339	missense	probably benign	0.07
R6637:Alms1	UTSW	6	85619734	missense	possibly damaging	0.78
R6866:Alms1	UTSW	6	85621098	missense	possibly damaging	0.85
R6918:Alms1	UTSW	6	85622661	missense	possibly damaging	0.87
R7121:Alms1	UTSW	6	85624622	missense	probably damaging	1.00
R7179:Alms1	UTSW	6	85621369	missense	probably benign	0.09
R7334:Alms1	UTSW	6	85641450	missense	probably damaging	0.99
R7376:Alms1	UTSW	6	85622106	missense	probably benign	0.10
R7394:Alms1	UTSW	6	85622223	missense	possibly damaging	0.54
R7413:Alms1	UTSW	6	85628306	missense	probably benign	0.03
R7511:Alms1	UTSW	6	85609425	missense	unknown
R7542:Alms1	UTSW	6	85629362	missense	possibly damaging	0.62
R7562:Alms1	UTSW	6	85620412	missense	probably damaging	1.00
R7575:Alms1	UTSW	6	85622159	missense	possibly damaging	0.49
R7577:Alms1	UTSW	6	85615320	missense	probably benign	0.09
R7618:Alms1	UTSW	6	85678417	missense	probably benign	0.07
R7653:Alms1	UTSW	6	85620595	missense	possibly damaging	0.47
R7672:Alms1	UTSW	6	85615351	missense	probably damaging	1.00
R7807:Alms1	UTSW	6	85622976	missense	possibly damaging	0.91
R7815:Alms1	UTSW	6	85615358	missense	probably benign	0.42
R7849:Alms1	UTSW	6	85621497	missense	possibly damaging	0.48
R7944:Alms1	UTSW	6	85641380	missense	probably benign	0.03
R7954:Alms1	UTSW	6	85621162	missense	probably damaging	0.98
R7971:Alms1	UTSW	6	85628679	missense	probably benign
R8048:Alms1	UTSW	6	85641334	missense	probably benign	0.13
R8223:Alms1	UTSW	6	85643240	nonsense	probably null
R8332:Alms1	UTSW	6	85620579	missense	probably benign	0.05
R8374:Alms1	UTSW	6	85608991	missense	probably benign	0.41
R8470:Alms1	UTSW	6	85641375	missense	probably damaging	0.99
R8755:Alms1	UTSW	6	85621574	missense	probably benign	0.01
R8979:Alms1	UTSW	6	85621027	missense	probably damaging	0.98
R9044:Alms1	UTSW	6	85696753	missense	probably damaging	0.98
R9057:Alms1	UTSW	6	85609832	missense	unknown
R9224:Alms1	UTSW	6	85621788	missense	possibly damaging	0.69
R9259:Alms1	UTSW	6	85667891	missense	possibly damaging	0.94
R9401:Alms1	UTSW	6	85678019	nonsense	probably null
R9459:Alms1	UTSW	6	85627964	missense	probably damaging	0.98
R9633:Alms1	UTSW	6	85623143	missense	probably damaging	0.99
R9716:Alms1	UTSW	6	85601252	missense	possibly damaging	0.84
R9730:Alms1	UTSW	6	85629438	missense	probably benign	0.00
R9790:Alms1	UTSW	6	85619443	missense	probably benign	0.04
R9791:Alms1	UTSW	6	85619443	missense	probably benign	0.04
R9802:Alms1	UTSW	6	85629238	missense	possibly damaging	0.61
X0013:Alms1	UTSW	6	85656455	missense	probably damaging	1.00
X0025:Alms1	UTSW	6	85620210	missense	probably damaging	0.96
Z1176:Alms1	UTSW	6	85678418	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- AATCCTCCACAACTGATGTTTGTACCC -3'
(R):5'- TGTGCAGCCAATGAATCTGTACTACC -3'

Sequencing Primer
(F):5'- CAACTGATGTTTGTACCCAGAGG -3'
(R):5'- TGAATCTGTACTACCATAGCCATC -3'

Posted On

2014-05-14