Incidental Mutation 'R1699:Adam8'
ID 192518
Institutional Source Beutler Lab
Gene Symbol Adam8
Ensembl Gene ENSMUSG00000025473
Gene Name a disintegrin and metallopeptidase domain 8
Synonyms CD156, MS2, E430039A18Rik, CD156a
MMRRC Submission 039732-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1699 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 139978932-139992562 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 139983311 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 767 (N767K)
Ref Sequence ENSEMBL: ENSMUSP00000101684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026546] [ENSMUST00000097970] [ENSMUST00000106069] [ENSMUST00000121412] [ENSMUST00000148670] [ENSMUST00000210254] [ENSMUST00000209335]
AlphaFold Q05910
Predicted Effect possibly damaging
Transcript: ENSMUST00000026546
AA Change: N766K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000026546
Gene: ENSMUSG00000025473
AA Change: N766K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 5.9e-35 PFAM
Pfam:Reprolysin_5 193 371 1e-22 PFAM
Pfam:Reprolysin_4 193 384 1.7e-16 PFAM
Pfam:Reprolysin 195 394 2.7e-70 PFAM
Pfam:Reprolysin_2 214 384 1.6e-16 PFAM
Pfam:Reprolysin_3 218 339 4.9e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 606 2.15e-35 SMART
EGF 613 642 3.06e-1 SMART
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 732 762 N/A INTRINSIC
low complexity region 770 783 N/A INTRINSIC
low complexity region 784 812 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097970
SMART Domains Protein: ENSMUSP00000095584
Gene: ENSMUSG00000073795

DomainStartEndE-ValueType
Pfam:CH_2 22 118 3e-35 PFAM
Pfam:CAMSAP_CH 23 105 1.2e-21 PFAM
coiled coil region 237 276 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106069
AA Change: N767K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101684
Gene: ENSMUSG00000025473
AA Change: N767K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 152 4e-30 PFAM
Pfam:Reprolysin_5 194 372 9.6e-23 PFAM
Pfam:Reprolysin_4 194 385 1.6e-16 PFAM
Pfam:Reprolysin 196 395 2.2e-73 PFAM
Pfam:Reprolysin_2 215 385 2.9e-18 PFAM
Pfam:Reprolysin_3 219 340 6.6e-21 PFAM
DISIN 412 487 5.16e-36 SMART
ACR 488 607 2.15e-35 SMART
EGF 614 643 3.06e-1 SMART
transmembrane domain 661 683 N/A INTRINSIC
low complexity region 733 763 N/A INTRINSIC
low complexity region 771 784 N/A INTRINSIC
low complexity region 785 813 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121412
SMART Domains Protein: ENSMUSP00000113338
Gene: ENSMUSG00000073795

DomainStartEndE-ValueType
Pfam:DUF1042 22 153 4.5e-35 PFAM
Pfam:CAMSAP_CH 23 105 1.3e-20 PFAM
low complexity region 230 246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146974
Predicted Effect probably benign
Transcript: ENSMUST00000148670
SMART Domains Protein: ENSMUSP00000117858
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 1.8e-35 PFAM
Pfam:Reprolysin_5 193 371 3.6e-23 PFAM
Pfam:Reprolysin_4 193 384 6e-17 PFAM
Pfam:Reprolysin 195 394 8.2e-71 PFAM
Pfam:Reprolysin_2 214 384 5.8e-17 PFAM
Pfam:Reprolysin_3 218 339 1.7e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 612 2.21e-32 SMART
EGF 619 648 3.06e-1 SMART
transmembrane domain 666 688 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185038
Predicted Effect probably benign
Transcript: ENSMUST00000210254
Predicted Effect probably benign
Transcript: ENSMUST00000209335
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Adam family of proteins that contain the disintegrin and metalloprotease domains. The encoded protein is localized to the cell surface, where it is involved in the remodeling of extracellular matrix and cell migration. Mice lacking the encoded protein display persistent inflammation upon treatment with allergens. Alternative splicing of this gene results in multiple variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice do not exhibit any morphological or pathological abnormalities. Mice homozygous for a different knock-out allele exhibit reduced osteoclast differentiation and calvarial fibrosis in response to TNF-alpha treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A G 5: 30,483,866 probably null Het
Abca2 A G 2: 25,447,351 E2406G possibly damaging Het
Adam6b T A 12: 113,490,585 F341I probably benign Het
AI481877 T C 4: 59,113,926 K13R unknown Het
Aig1 T C 10: 13,868,622 D46G possibly damaging Het
Alms1 A G 6: 85,622,880 I2032V possibly damaging Het
Ankrd16 A G 2: 11,784,393 I264V probably benign Het
Areg T G 5: 91,143,498 V100G probably damaging Het
Bcan A G 3: 87,989,236 Y718H probably damaging Het
Brsk2 T A 7: 141,985,463 I188N probably damaging Het
Ccdc189 A T 7: 127,586,856 probably null Het
Cdt1 T C 8: 122,569,983 Y203H probably damaging Het
Chil3 A C 3: 106,160,366 probably null Het
Cth A G 3: 157,907,436 L253P probably damaging Het
Cyp11b1 A G 15: 74,840,817 F132L possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah11 A G 12: 118,190,868 S226P probably damaging Het
Egfr A T 11: 16,859,019 Q71L probably benign Het
Eml6 T A 11: 29,746,282 K1940* probably null Het
Epn2 T A 11: 61,523,188 K391* probably null Het
Erich1 A T 8: 14,090,259 S2T possibly damaging Het
Evi5 A C 5: 107,818,920 L245R probably damaging Het
Evpl T C 11: 116,227,588 Y731C probably damaging Het
Exoc3l G A 8: 105,295,013 H128Y probably benign Het
Extl1 G A 4: 134,364,583 Q320* probably null Het
Fam71a T A 1: 191,163,821 E208D probably benign Het
Fam91a1 T A 15: 58,432,948 S416T probably benign Het
Fam96b A G 8: 104,640,086 V132A probably damaging Het
Fat3 A T 9: 15,938,398 S3903T probably damaging Het
Fer1l4 A G 2: 156,029,685 F1392L probably benign Het
Fstl4 T C 11: 53,168,178 I488T possibly damaging Het
Gak A T 5: 108,604,377 Y338* probably null Het
Glp2r T C 11: 67,757,541 T112A probably benign Het
Glrb G A 3: 80,861,774 T180I probably damaging Het
Gm10118 C T 10: 63,926,892 probably benign Het
Gpr19 A T 6: 134,870,229 F72I possibly damaging Het
Grin3b C A 10: 79,975,882 N740K probably damaging Het
Gstk1 A T 6: 42,246,601 T42S probably benign Het
Hoxd1 G A 2: 74,764,282 A294T probably benign Het
Hspg2 T A 4: 137,548,012 probably null Het
Ift74 A T 4: 94,685,703 N472I probably benign Het
Il1a C T 2: 129,302,893 D202N probably damaging Het
Islr T C 9: 58,157,495 D243G probably damaging Het
Kif21a C T 15: 90,959,743 E1098K probably damaging Het
Krtap16-1 T C 11: 99,986,026 E184G probably damaging Het
Lrp1b A G 2: 41,185,962 I1889T possibly damaging Het
Mcpt4 A G 14: 56,059,959 *247Q probably null Het
Megf10 T C 18: 57,277,730 probably null Het
Mettl2 T A 11: 105,139,718 H373Q probably benign Het
Mocos A G 18: 24,683,216 K617E probably damaging Het
Ms4a8a A G 19: 11,076,397 I115T probably damaging Het
Ndst1 T C 18: 60,695,508 Y658C probably damaging Het
Nin C A 12: 70,045,563 K657N possibly damaging Het
Nin G A 12: 70,030,938 A1031V probably benign Het
Noc4l G A 5: 110,649,847 R344* probably null Het
Notch2 T C 3: 98,145,127 S1980P probably damaging Het
Npat C T 9: 53,562,660 S584L probably benign Het
Nphp4 A G 4: 152,496,664 T102A probably damaging Het
Olfml2b A G 1: 170,645,073 N51S possibly damaging Het
Olfr1042 T C 2: 86,159,936 I145V probably benign Het
Olfr138 A G 17: 38,275,041 K90R probably benign Het
Olfr1388 T A 11: 49,444,289 I146N possibly damaging Het
Olfr153 A G 2: 87,532,083 T17A probably benign Het
Pced1b T A 15: 97,384,877 W266R probably damaging Het
Pdcd6ip A G 9: 113,678,354 V378A probably damaging Het
Pde8b T A 13: 95,032,866 K683N probably damaging Het
Pfas T G 11: 68,998,046 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plcd4 T G 1: 74,548,235 S51R probably benign Het
Plekhh2 T A 17: 84,577,184 Y775* probably null Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Ppp4r3b C T 11: 29,213,765 T47I possibly damaging Het
Pter A T 2: 12,994,761 D169V probably damaging Het
Ptpn12 A G 5: 20,998,170 S537P probably benign Het
Ptpru T A 4: 131,779,050 D1067V probably damaging Het
Rcn1 A T 2: 105,399,005 D67E probably damaging Het
Rfc4 T C 16: 23,114,233 E318G probably benign Het
Samd13 C A 3: 146,662,714 R41L probably benign Het
Slc6a2 T C 8: 92,972,812 I156T possibly damaging Het
Spag16 T C 1: 69,996,856 F348L probably benign Het
Spag4 T C 2: 156,065,422 Y21H probably damaging Het
Stam2 G A 2: 52,703,175 A368V possibly damaging Het
Stc1 A T 14: 69,038,327 M190L probably benign Het
Stxbp1 A G 2: 32,800,617 L475P probably damaging Het
Syn3 A T 10: 86,080,211 Y304N probably damaging Het
Tbc1d15 G T 10: 115,220,314 T251K probably benign Het
Tbpl2 A T 2: 24,095,045 M29K probably benign Het
Tead3 T G 17: 28,334,724 Q170H possibly damaging Het
Tpbpb T C 13: 60,902,163 N51D probably benign Het
Tstd3 A G 4: 21,759,400 M124T probably benign Het
Ttyh1 T A 7: 4,119,696 H14Q possibly damaging Het
Tubgcp4 G A 2: 121,189,893 W449* probably null Het
Txndc11 A G 16: 11,087,775 probably null Het
Usp24 T A 4: 106,438,827 D2615E probably damaging Het
Vars A G 17: 35,014,758 E1020G possibly damaging Het
Vmn2r58 A G 7: 41,860,527 I542T probably benign Het
Vwf A T 6: 125,685,900 Y2749F possibly damaging Het
Vwf A G 6: 125,643,069 Y1570C probably damaging Het
Zfand1 A C 3: 10,341,055 V198G possibly damaging Het
Zfp536 G A 7: 37,569,454 T179I probably damaging Het
Zfp599 T C 9: 22,250,404 Y155C probably benign Het
Other mutations in Adam8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Adam8 APN 7 139987245 missense probably damaging 1.00
IGL02044:Adam8 APN 7 139982822 missense possibly damaging 0.85
IGL02228:Adam8 APN 7 139988806 splice site probably null
IGL02257:Adam8 APN 7 139987648 missense possibly damaging 0.88
IGL03101:Adam8 APN 7 139988543 missense possibly damaging 0.56
R0320:Adam8 UTSW 7 139986442 missense probably damaging 1.00
R0384:Adam8 UTSW 7 139986812 unclassified probably benign
R1169:Adam8 UTSW 7 139983929 missense probably benign 0.11
R1340:Adam8 UTSW 7 139991377 missense probably damaging 0.99
R3725:Adam8 UTSW 7 139983868 missense possibly damaging 0.63
R3874:Adam8 UTSW 7 139987607 missense probably damaging 1.00
R4716:Adam8 UTSW 7 139983938 missense probably benign 0.31
R4754:Adam8 UTSW 7 139984780 missense possibly damaging 0.87
R4907:Adam8 UTSW 7 139989373 missense probably benign 0.03
R5345:Adam8 UTSW 7 139987639 missense probably benign 0.03
R5579:Adam8 UTSW 7 139988984 missense probably benign 0.03
R5696:Adam8 UTSW 7 139989246 missense probably benign 0.03
R5805:Adam8 UTSW 7 139985881 missense probably damaging 1.00
R5948:Adam8 UTSW 7 139987884 missense probably benign 0.07
R5991:Adam8 UTSW 7 139990287 missense probably damaging 1.00
R6280:Adam8 UTSW 7 139984807 missense probably damaging 0.99
R6456:Adam8 UTSW 7 139986788 missense possibly damaging 0.96
R7098:Adam8 UTSW 7 139979499 missense possibly damaging 0.53
R7105:Adam8 UTSW 7 139990055 missense probably benign 0.00
R7334:Adam8 UTSW 7 139988990 missense probably damaging 1.00
R7342:Adam8 UTSW 7 139986391 missense probably benign 0.00
R7382:Adam8 UTSW 7 139990107 missense possibly damaging 0.74
R7425:Adam8 UTSW 7 139992481 unclassified probably benign
R7507:Adam8 UTSW 7 139987178 critical splice donor site probably null
R7637:Adam8 UTSW 7 139985430 missense probably damaging 0.98
R7904:Adam8 UTSW 7 139987678 missense probably benign 0.17
R8024:Adam8 UTSW 7 139987576 missense probably damaging 1.00
R8176:Adam8 UTSW 7 139988873 missense probably benign 0.03
R8438:Adam8 UTSW 7 139985336 critical splice donor site probably null
R8439:Adam8 UTSW 7 139987849 missense probably benign 0.25
R9077:Adam8 UTSW 7 139987639 missense probably benign 0.03
R9312:Adam8 UTSW 7 139985878 missense probably damaging 1.00
R9346:Adam8 UTSW 7 139987721 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAATCAAGGCTGTCTCCTTACCTGC -3'
(R):5'- GCTTCTTAACTGAGGAATGGGCTGC -3'

Sequencing Primer
(F):5'- gctgccttcagacactcc -3'
(R):5'- CTAGCCTAGAGAGAACAGGAAAG -3'
Posted On 2014-05-14