Incidental Mutation 'R1699:Egfr'
ID192537
Institutional Source Beutler Lab
Gene Symbol Egfr
Ensembl Gene ENSMUSG00000020122
Gene Nameepidermal growth factor receptor
Synonymsavian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, 9030024J15Rik, Erbb, Errb1
MMRRC Submission 039732-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R1699 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location16752203-16918158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16859019 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 71 (Q71L)
Ref Sequence ENSEMBL: ENSMUSP00000099948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020329] [ENSMUST00000102884]
Predicted Effect probably benign
Transcript: ENSMUST00000020329
AA Change: Q71L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: Q71L

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 1.4e-32 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 1.8e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.05e1 SMART
low complexity region 677 694 N/A INTRINSIC
TyrKc 714 970 2.88e-129 SMART
low complexity region 1004 1017 N/A INTRINSIC
low complexity region 1027 1048 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102884
AA Change: Q71L

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099948
Gene: ENSMUSG00000020122
AA Change: Q71L

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 5e-33 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 2e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.54e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A G 5: 30,483,866 probably null Het
Abca2 A G 2: 25,447,351 E2406G possibly damaging Het
Adam6b T A 12: 113,490,585 F341I probably benign Het
Adam8 A T 7: 139,983,311 N767K possibly damaging Het
AI481877 T C 4: 59,113,926 K13R unknown Het
Aig1 T C 10: 13,868,622 D46G possibly damaging Het
Alms1 A G 6: 85,622,880 I2032V possibly damaging Het
Ankrd16 A G 2: 11,784,393 I264V probably benign Het
Areg T G 5: 91,143,498 V100G probably damaging Het
Bcan A G 3: 87,989,236 Y718H probably damaging Het
Brsk2 T A 7: 141,985,463 I188N probably damaging Het
Ccdc189 A T 7: 127,586,856 probably null Het
Cdt1 T C 8: 122,569,983 Y203H probably damaging Het
Chil3 A C 3: 106,160,366 probably null Het
Cth A G 3: 157,907,436 L253P probably damaging Het
Cyp11b1 A G 15: 74,840,817 F132L possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah11 A G 12: 118,190,868 S226P probably damaging Het
Eml6 T A 11: 29,746,282 K1940* probably null Het
Epn2 T A 11: 61,523,188 K391* probably null Het
Erich1 A T 8: 14,090,259 S2T possibly damaging Het
Evi5 A C 5: 107,818,920 L245R probably damaging Het
Evpl T C 11: 116,227,588 Y731C probably damaging Het
Exoc3l G A 8: 105,295,013 H128Y probably benign Het
Extl1 G A 4: 134,364,583 Q320* probably null Het
Fam71a T A 1: 191,163,821 E208D probably benign Het
Fam91a1 T A 15: 58,432,948 S416T probably benign Het
Fam96b A G 8: 104,640,086 V132A probably damaging Het
Fat3 A T 9: 15,938,398 S3903T probably damaging Het
Fer1l4 A G 2: 156,029,685 F1392L probably benign Het
Fstl4 T C 11: 53,168,178 I488T possibly damaging Het
Gak A T 5: 108,604,377 Y338* probably null Het
Glp2r T C 11: 67,757,541 T112A probably benign Het
Glrb G A 3: 80,861,774 T180I probably damaging Het
Gm10118 C T 10: 63,926,892 probably benign Het
Gpr19 A T 6: 134,870,229 F72I possibly damaging Het
Grin3b C A 10: 79,975,882 N740K probably damaging Het
Gstk1 A T 6: 42,246,601 T42S probably benign Het
Hoxd1 G A 2: 74,764,282 A294T probably benign Het
Hspg2 T A 4: 137,548,012 probably null Het
Ift74 A T 4: 94,685,703 N472I probably benign Het
Il1a C T 2: 129,302,893 D202N probably damaging Het
Islr T C 9: 58,157,495 D243G probably damaging Het
Kif21a C T 15: 90,959,743 E1098K probably damaging Het
Krtap16-1 T C 11: 99,986,026 E184G probably damaging Het
Lrp1b A G 2: 41,185,962 I1889T possibly damaging Het
Mcpt4 A G 14: 56,059,959 *247Q probably null Het
Megf10 T C 18: 57,277,730 probably null Het
Mettl2 T A 11: 105,139,718 H373Q probably benign Het
Mocos A G 18: 24,683,216 K617E probably damaging Het
Ms4a8a A G 19: 11,076,397 I115T probably damaging Het
Ndst1 T C 18: 60,695,508 Y658C probably damaging Het
Nin G A 12: 70,030,938 A1031V probably benign Het
Nin C A 12: 70,045,563 K657N possibly damaging Het
Noc4l G A 5: 110,649,847 R344* probably null Het
Notch2 T C 3: 98,145,127 S1980P probably damaging Het
Npat C T 9: 53,562,660 S584L probably benign Het
Nphp4 A G 4: 152,496,664 T102A probably damaging Het
Olfml2b A G 1: 170,645,073 N51S possibly damaging Het
Olfr1042 T C 2: 86,159,936 I145V probably benign Het
Olfr138 A G 17: 38,275,041 K90R probably benign Het
Olfr1388 T A 11: 49,444,289 I146N possibly damaging Het
Olfr153 A G 2: 87,532,083 T17A probably benign Het
Pced1b T A 15: 97,384,877 W266R probably damaging Het
Pdcd6ip A G 9: 113,678,354 V378A probably damaging Het
Pde8b T A 13: 95,032,866 K683N probably damaging Het
Pfas T G 11: 68,998,046 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plcd4 T G 1: 74,548,235 S51R probably benign Het
Plekhh2 T A 17: 84,577,184 Y775* probably null Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Ppp4r3b C T 11: 29,213,765 T47I possibly damaging Het
Pter A T 2: 12,994,761 D169V probably damaging Het
Ptpn12 A G 5: 20,998,170 S537P probably benign Het
Ptpru T A 4: 131,779,050 D1067V probably damaging Het
Rcn1 A T 2: 105,399,005 D67E probably damaging Het
Rfc4 T C 16: 23,114,233 E318G probably benign Het
Samd13 C A 3: 146,662,714 R41L probably benign Het
Slc6a2 T C 8: 92,972,812 I156T possibly damaging Het
Spag16 T C 1: 69,996,856 F348L probably benign Het
Spag4 T C 2: 156,065,422 Y21H probably damaging Het
Stam2 G A 2: 52,703,175 A368V possibly damaging Het
Stc1 A T 14: 69,038,327 M190L probably benign Het
Stxbp1 A G 2: 32,800,617 L475P probably damaging Het
Syn3 A T 10: 86,080,211 Y304N probably damaging Het
Tbc1d15 G T 10: 115,220,314 T251K probably benign Het
Tbpl2 A T 2: 24,095,045 M29K probably benign Het
Tead3 T G 17: 28,334,724 Q170H possibly damaging Het
Tpbpb T C 13: 60,902,163 N51D probably benign Het
Tstd3 A G 4: 21,759,400 M124T probably benign Het
Ttyh1 T A 7: 4,119,696 H14Q possibly damaging Het
Tubgcp4 G A 2: 121,189,893 W449* probably null Het
Txndc11 A G 16: 11,087,775 probably null Het
Usp24 T A 4: 106,438,827 D2615E probably damaging Het
Vars A G 17: 35,014,758 E1020G possibly damaging Het
Vmn2r58 A G 7: 41,860,527 I542T probably benign Het
Vwf A G 6: 125,643,069 Y1570C probably damaging Het
Vwf A T 6: 125,685,900 Y2749F possibly damaging Het
Zfand1 A C 3: 10,341,055 V198G possibly damaging Het
Zfp536 G A 7: 37,569,454 T179I probably damaging Het
Zfp599 T C 9: 22,250,404 Y155C probably benign Het
Other mutations in Egfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Egfr APN 11 16863020 missense probably damaging 1.00
IGL01529:Egfr APN 11 16863014 missense probably benign
IGL01556:Egfr APN 11 16905382 missense probably damaging 1.00
IGL02627:Egfr APN 11 16869346 missense probably damaging 1.00
IGL02862:Egfr APN 11 16883562 missense probably benign 0.25
IGL02945:Egfr APN 11 16752514 missense probably damaging 1.00
IGL02994:Egfr APN 11 16911811 missense probably damaging 1.00
IGL03395:Egfr APN 11 16910261 splice site probably benign
set UTSW 11 16871881 splice site probably benign
Velvet UTSW 11 16904399 missense probably damaging 1.00
PIT1430001:Egfr UTSW 11 16910214 missense probably benign 0.00
R0196:Egfr UTSW 11 16911746 missense probably benign 0.02
R0513:Egfr UTSW 11 16872855 missense probably damaging 1.00
R0567:Egfr UTSW 11 16872873 missense probably benign 0.01
R0629:Egfr UTSW 11 16869333 missense probably damaging 1.00
R0961:Egfr UTSW 11 16862964 missense probably damaging 1.00
R1163:Egfr UTSW 11 16883546 missense probably benign 0.02
R1454:Egfr UTSW 11 16889920 missense probably benign
R1456:Egfr UTSW 11 16863065 missense probably benign 0.00
R1503:Egfr UTSW 11 16869301 missense possibly damaging 0.86
R1577:Egfr UTSW 11 16869241 missense probably benign 0.04
R1595:Egfr UTSW 11 16906847 missense probably damaging 0.99
R2172:Egfr UTSW 11 16911562 missense probably benign 0.00
R3690:Egfr UTSW 11 16871881 splice site probably benign
R3922:Egfr UTSW 11 16881495 missense probably damaging 1.00
R4444:Egfr UTSW 11 16871027 missense probably benign 0.00
R4685:Egfr UTSW 11 16858980 missense probably damaging 1.00
R4737:Egfr UTSW 11 16869231 missense probably damaging 0.99
R4814:Egfr UTSW 11 16869354 missense probably damaging 1.00
R4841:Egfr UTSW 11 16911607 missense probably benign 0.05
R4842:Egfr UTSW 11 16911607 missense probably benign 0.05
R4903:Egfr UTSW 11 16908949 missense probably damaging 1.00
R4964:Egfr UTSW 11 16908949 missense probably damaging 1.00
R4985:Egfr UTSW 11 16859029 nonsense probably null
R4998:Egfr UTSW 11 16881493 missense possibly damaging 0.58
R5001:Egfr UTSW 11 16904434 missense probably damaging 0.98
R5304:Egfr UTSW 11 16884260 missense probably benign
R5309:Egfr UTSW 11 16911703 missense probably benign 0.00
R5653:Egfr UTSW 11 16911617 missense probably benign 0.04
R5905:Egfr UTSW 11 16911494 missense probably damaging 1.00
R6051:Egfr UTSW 11 16883607 missense possibly damaging 0.87
R6052:Egfr UTSW 11 16911554 missense probably benign 0.16
R6114:Egfr UTSW 11 16904374 missense possibly damaging 0.46
R6261:Egfr UTSW 11 16889964 missense probably benign 0.11
R6434:Egfr UTSW 11 16869294 missense probably benign 0.25
R6475:Egfr UTSW 11 16891259 missense probably benign
R6799:Egfr UTSW 11 16896952 missense probably damaging 1.00
R7143:Egfr UTSW 11 16871627 missense probably benign 0.20
R7195:Egfr UTSW 11 16868162 missense probably damaging 1.00
R7459:Egfr UTSW 11 16896967 missense probably damaging 1.00
R7612:Egfr UTSW 11 16859025 missense possibly damaging 0.74
R7757:Egfr UTSW 11 16889966 missense possibly damaging 0.64
R7763:Egfr UTSW 11 16891266 missense probably damaging 1.00
R8315:Egfr UTSW 11 16875027 missense probably benign 0.08
R8320:Egfr UTSW 11 16891251 missense probably damaging 1.00
R8324:Egfr UTSW 11 16858971 missense probably damaging 0.99
R8324:Egfr UTSW 11 16908885 missense probably damaging 0.98
R8347:Egfr UTSW 11 16878174 missense probably damaging 1.00
R8511:Egfr UTSW 11 16896949 missense probably damaging 1.00
Z1177:Egfr UTSW 11 16862954 missense probably benign 0.05
Z1177:Egfr UTSW 11 16869319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTGTGGCTCCCAAAGTTGATG -3'
(R):5'- CCTTCCACAAACAGTGGTCCTAGC -3'

Sequencing Primer
(F):5'- GTTGTGGTTTACTACCATACTCAG -3'
(R):5'- tcagaaatccgcctgcc -3'
Posted On2014-05-14