Incidental Mutation 'R0574:Usp54'
ID192607
Institutional Source Beutler Lab
Gene Symbol Usp54
Ensembl Gene ENSMUSG00000034235
Gene Nameubiquitin specific peptidase 54
SynonymsC030002J06Rik, 4930429G18Rik
MMRRC Submission 038764-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0574 (G1)
Quality Score43
Status Validated
Chromosome14
Chromosomal Location20548912-20641063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20556254 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1338 (V1338A)
Ref Sequence ENSEMBL: ENSMUSP00000036214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022356] [ENSMUST00000035340]
Predicted Effect probably benign
Transcript: ENSMUST00000022356
AA Change: V1338A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000022356
Gene: ENSMUSG00000034235
AA Change: V1338A

DomainStartEndE-ValueType
Pfam:UCH 30 349 2.4e-23 PFAM
Pfam:UCH_1 31 324 2.1e-7 PFAM
low complexity region 403 412 N/A INTRINSIC
low complexity region 439 445 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
coiled coil region 682 712 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 881 894 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035340
AA Change: V1338A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000036214
Gene: ENSMUSG00000034235
AA Change: V1338A

DomainStartEndE-ValueType
Pfam:UCH 31 349 2.3e-21 PFAM
low complexity region 403 412 N/A INTRINSIC
low complexity region 439 445 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
coiled coil region 682 712 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 881 894 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142099
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700099C18Rik T C 17: 94,761,491 noncoding transcript Het
Abca14 A G 7: 120,224,497 I416V probably damaging Het
Actrt3 T C 3: 30,599,680 E57G probably benign Het
Adamts5 A G 16: 85,899,484 S262P probably damaging Het
Aldh1a2 T C 9: 71,281,708 probably null Het
Arhgap29 A G 3: 122,007,625 I670V probably benign Het
Bptf T C 11: 107,076,527 D1009G probably damaging Het
Ddr2 G T 1: 169,981,963 probably benign Het
Ift140 T A 17: 25,051,760 probably null Het
Itga1 A C 13: 114,966,561 S1111R probably damaging Het
Klk1b27 T A 7: 44,056,101 L199Q probably damaging Het
Lhx3 T C 2: 26,201,311 S329G probably benign Het
Man2b1 T G 8: 85,096,776 M913R probably benign Het
Mmp15 G A 8: 95,365,401 A80T possibly damaging Het
Mpo A T 11: 87,796,076 Y177F probably damaging Het
Mynn T C 3: 30,616,739 S587P probably benign Het
Nfkbib C T 7: 28,761,788 V145I probably benign Het
Olfr421-ps1 T C 1: 174,151,566 F17L probably benign Het
Olfr727 A T 14: 50,126,682 Y35F probably damaging Het
Olfr98 G T 17: 37,262,881 S261Y probably damaging Het
Pole2 G A 12: 69,211,457 probably benign Het
Ppargc1b C T 18: 61,302,739 G906D probably benign Het
Prl8a2 T A 13: 27,348,900 C32S probably damaging Het
Rhno1 A T 6: 128,358,150 probably null Het
Rprd2 T C 3: 95,774,357 E408G possibly damaging Het
Ryr2 T A 13: 11,731,669 H1999L probably benign Het
Shprh T C 10: 11,163,077 probably benign Het
Snx3 T A 10: 42,502,387 N19K probably benign Het
Stx8 C T 11: 67,973,252 T46M probably damaging Het
Tbc1d17 A G 7: 44,843,123 probably benign Het
Ush1c A G 7: 46,196,804 S855P possibly damaging Het
Vmn1r214 A G 13: 23,034,493 I52M probably benign Het
Other mutations in Usp54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Usp54 APN 14 20573837 missense probably damaging 1.00
IGL01090:Usp54 APN 14 20586157 unclassified probably benign
IGL02030:Usp54 APN 14 20565946 missense probably benign 0.44
IGL02333:Usp54 APN 14 20589395 missense probably damaging 1.00
IGL02642:Usp54 APN 14 20565072 splice site probably benign
IGL02970:Usp54 APN 14 20577472 missense probably damaging 1.00
IGL03371:Usp54 APN 14 20589368 unclassified probably benign
BB003:Usp54 UTSW 14 20576968 missense probably damaging 1.00
BB013:Usp54 UTSW 14 20576968 missense probably damaging 1.00
R0050:Usp54 UTSW 14 20573755 unclassified probably benign
R0383:Usp54 UTSW 14 20561252 missense probably benign 0.00
R0427:Usp54 UTSW 14 20570364 missense probably benign
R0442:Usp54 UTSW 14 20607209 missense probably damaging 1.00
R0638:Usp54 UTSW 14 20589369 unclassified probably benign
R0789:Usp54 UTSW 14 20562157 missense probably benign 0.01
R1272:Usp54 UTSW 14 20561110 missense probably damaging 0.99
R1463:Usp54 UTSW 14 20550190 missense probably benign 0.15
R1565:Usp54 UTSW 14 20607159 missense probably damaging 1.00
R1721:Usp54 UTSW 14 20583440 nonsense probably null
R1922:Usp54 UTSW 14 20560904 missense probably benign 0.00
R2068:Usp54 UTSW 14 20577205 missense probably damaging 1.00
R2216:Usp54 UTSW 14 20561840 missense probably benign
R2285:Usp54 UTSW 14 20561178 missense possibly damaging 0.52
R2426:Usp54 UTSW 14 20564940 missense probably benign 0.00
R3855:Usp54 UTSW 14 20588420 missense probably damaging 1.00
R3856:Usp54 UTSW 14 20588420 missense probably damaging 1.00
R3907:Usp54 UTSW 14 20586113 missense probably damaging 1.00
R4367:Usp54 UTSW 14 20561134 missense probably benign 0.02
R4384:Usp54 UTSW 14 20550085 splice site probably null
R4555:Usp54 UTSW 14 20561022 missense probably benign 0.06
R4617:Usp54 UTSW 14 20550338 missense probably benign 0.04
R4659:Usp54 UTSW 14 20564992 missense probably damaging 1.00
R4672:Usp54 UTSW 14 20581529 intron probably benign
R4928:Usp54 UTSW 14 20562192 missense probably damaging 1.00
R5381:Usp54 UTSW 14 20586076 missense probably damaging 1.00
R5408:Usp54 UTSW 14 20550433 missense probably damaging 1.00
R5630:Usp54 UTSW 14 20565057 missense probably damaging 1.00
R5841:Usp54 UTSW 14 20550283 missense probably benign 0.04
R5886:Usp54 UTSW 14 20561842 missense probably benign 0.28
R5922:Usp54 UTSW 14 20552071 splice site probably null
R5975:Usp54 UTSW 14 20583351 missense possibly damaging 0.77
R6074:Usp54 UTSW 14 20552099 missense probably benign 0.02
R6183:Usp54 UTSW 14 20552245 missense probably damaging 0.99
R6234:Usp54 UTSW 14 20583450 missense probably damaging 1.00
R6303:Usp54 UTSW 14 20560968 missense possibly damaging 0.95
R6304:Usp54 UTSW 14 20560968 missense possibly damaging 0.95
R6695:Usp54 UTSW 14 20560869 missense possibly damaging 0.94
R6774:Usp54 UTSW 14 20577228 missense probably damaging 1.00
R6941:Usp54 UTSW 14 20562109 missense probably benign
R7133:Usp54 UTSW 14 20561242 missense probably benign 0.00
R7196:Usp54 UTSW 14 20588370 missense probably damaging 1.00
R7409:Usp54 UTSW 14 20552245 missense probably damaging 0.99
R7424:Usp54 UTSW 14 20577040 missense probably benign 0.15
R7859:Usp54 UTSW 14 20588136 missense probably benign 0.24
R7926:Usp54 UTSW 14 20576968 missense probably damaging 1.00
R7954:Usp54 UTSW 14 20561913 missense probably benign 0.01
RF004:Usp54 UTSW 14 20561300 missense possibly damaging 0.90
X0024:Usp54 UTSW 14 20577251 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AACTTCCTGGAACGCACTGAGCTG -3'
(R):5'- TTCAAGGACCATGCCTCTGCACTG -3'

Sequencing Primer
(F):5'- CGCACTGAGCTGGAGAG -3'
(R):5'- GAGAGAAAGCCATGTTTGTTCTTCC -3'
Posted On2014-05-14