Incidental Mutation 'R0345:Myo5c'
Institutional Source Beutler Lab
Gene Symbol Myo5c
Ensembl Gene ENSMUSG00000033590
Gene Namemyosin VC
MMRRC Submission 038552-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0345 (G1)
Quality Score36
Status Validated
Chromosomal Location75232020-75305451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75297419 bp
Amino Acid Change Glutamic Acid to Glycine at position 1518 (E1518G)
Ref Sequence ENSEMBL: ENSMUSP00000042229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036555]
Predicted Effect probably damaging
Transcript: ENSMUST00000036555
AA Change: E1518G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042229
Gene: ENSMUSG00000033590
AA Change: E1518G

MYSc 61 754 N/A SMART
IQ 755 777 1.11e-3 SMART
IQ 778 800 1.39e0 SMART
IQ 806 828 8.98e-4 SMART
IQ 829 851 4.19e-4 SMART
IQ 854 876 2.54e-3 SMART
coiled coil region 1160 1185 N/A INTRINSIC
coiled coil region 1207 1245 N/A INTRINSIC
DIL 1574 1679 5.54e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216529
Meta Mutation Damage Score 0.2350 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T C 14: 59,139,630 N105D possibly damaging Het
A2m T C 6: 121,638,272 probably benign Het
Adgrb1 A G 15: 74,543,349 N641S probably damaging Het
Aff4 T A 11: 53,372,881 S243T probably benign Het
Agap2 A G 10: 127,087,895 H713R unknown Het
Ap2a2 T A 7: 141,631,293 M914K probably damaging Het
Bcl7c A T 7: 127,708,463 M22K possibly damaging Het
Cacna1i A T 15: 80,372,462 D1019V probably damaging Het
Cd7 T C 11: 121,038,186 T80A probably benign Het
Chia1 T C 3: 106,122,439 Y130H probably damaging Het
Chmp6 T C 11: 119,918,046 probably benign Het
Chrnb4 A G 9: 55,035,594 V132A probably benign Het
Ctnna3 A G 10: 63,566,840 D110G probably benign Het
Cyp2d37-ps A T 15: 82,689,774 noncoding transcript Het
Dnah6 T C 6: 73,021,257 M4061V probably benign Het
Dydc2 C A 14: 41,061,946 M73I probably benign Het
Egflam G T 15: 7,289,994 probably null Het
Fam205a1 T C 4: 42,851,116 I347V probably benign Het
Fam228b C T 12: 4,748,351 V151I possibly damaging Het
Fam46b A T 4: 133,486,211 Q131L probably benign Het
Fanca C T 8: 123,304,813 V380I probably damaging Het
Gbp2b T C 3: 142,608,183 L408S probably damaging Het
Kcnh4 T C 11: 100,757,681 S66G probably benign Het
Kcnq3 A T 15: 66,020,305 V407D possibly damaging Het
Kif24 A T 4: 41,428,413 D182E probably benign Het
Llgl2 A G 11: 115,849,992 probably benign Het
Lmo7 T A 14: 101,876,877 N140K probably damaging Het
Myof A T 19: 38,024,345 N47K probably damaging Het
Nckap1 G T 2: 80,544,977 probably benign Het
Nlrp1a C A 11: 71,123,675 G250W probably damaging Het
Nol4l T A 2: 153,411,752 S390C probably benign Het
Olfr196 G A 16: 59,167,906 P79L possibly damaging Het
Olfr670 T A 7: 104,960,181 M184L probably damaging Het
Olfr701 T C 7: 106,818,701 F206S probably benign Het
Olfr992 T C 2: 85,400,341 Q64R possibly damaging Het
Plec G T 15: 76,177,167 P2886T probably damaging Het
Prdm16 T C 4: 154,341,111 Y738C probably benign Het
Ptprz1 A G 6: 23,016,165 Y820C probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgce G A 6: 4,718,019 P98S probably damaging Het
Siglecf T C 7: 43,351,944 F112S probably damaging Het
Slc6a16 C T 7: 45,259,248 A84V possibly damaging Het
Sntb2 T C 8: 107,001,538 S373P probably damaging Het
Sorcs2 C T 5: 36,027,874 V953I probably benign Het
St7l T C 3: 104,895,809 probably benign Het
Stap2 A G 17: 56,000,097 V217A probably damaging Het
Stxbp5l A T 16: 37,288,308 D215E probably damaging Het
Synm C T 7: 67,735,821 V256I probably benign Het
Syt13 A C 2: 92,946,067 E233A possibly damaging Het
Tecta T A 9: 42,384,218 E327V probably damaging Het
Themis3 A T 17: 66,559,545 probably null Het
Ttll13 T A 7: 80,247,336 D14E probably benign Het
Tubb2a A C 13: 34,076,637 D26E probably benign Het
Ubr1 T C 2: 120,904,103 probably null Het
Vps13d A T 4: 145,117,625 V2537E possibly damaging Het
Zscan10 T A 17: 23,610,082 F456I probably damaging Het
Zyg11b A G 4: 108,266,407 I121T probably damaging Het
Other mutations in Myo5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Myo5c APN 9 75242880 splice site probably benign
IGL00848:Myo5c APN 9 75289181 missense probably benign
IGL01503:Myo5c APN 9 75263042 missense probably damaging 1.00
IGL01735:Myo5c APN 9 75301438 missense probably damaging 1.00
IGL01866:Myo5c APN 9 75269582 missense probably benign 0.00
IGL01956:Myo5c APN 9 75242876 splice site probably null
IGL02127:Myo5c APN 9 75300902 missense probably damaging 1.00
IGL02268:Myo5c APN 9 75246237 missense probably damaging 1.00
IGL02272:Myo5c APN 9 75266160 missense possibly damaging 0.73
IGL03052:Myo5c APN 9 75252516 splice site probably benign
IGL03179:Myo5c APN 9 75255866 missense possibly damaging 0.65
IGL03224:Myo5c APN 9 75278243 missense probably benign 0.01
PIT4142001:Myo5c UTSW 9 75283948 missense probably benign 0.00
PIT4431001:Myo5c UTSW 9 75252571 missense possibly damaging 0.75
R0126:Myo5c UTSW 9 75269525 missense probably benign 0.05
R0266:Myo5c UTSW 9 75284216 splice site probably benign
R0387:Myo5c UTSW 9 75285021 splice site probably benign
R0602:Myo5c UTSW 9 75266196 splice site probably null
R0675:Myo5c UTSW 9 75278289 missense probably benign
R0798:Myo5c UTSW 9 75257984 missense probably damaging 1.00
R0981:Myo5c UTSW 9 75271591 missense probably damaging 1.00
R1051:Myo5c UTSW 9 75290883 missense probably benign 0.00
R1072:Myo5c UTSW 9 75292208 missense probably damaging 1.00
R1144:Myo5c UTSW 9 75286448 missense probably damaging 1.00
R1454:Myo5c UTSW 9 75263066 missense possibly damaging 0.94
R1476:Myo5c UTSW 9 75275939 missense probably damaging 1.00
R1484:Myo5c UTSW 9 75300810 missense probably damaging 1.00
R1586:Myo5c UTSW 9 75267031 missense probably damaging 0.99
R1616:Myo5c UTSW 9 75296017 missense probably damaging 1.00
R1635:Myo5c UTSW 9 75277075 missense probably benign 0.09
R1800:Myo5c UTSW 9 75246164 missense probably damaging 1.00
R1838:Myo5c UTSW 9 75273553 missense probably damaging 1.00
R1840:Myo5c UTSW 9 75249735 missense probably damaging 1.00
R1885:Myo5c UTSW 9 75249761 missense probably damaging 1.00
R1897:Myo5c UTSW 9 75292241 missense probably benign 0.20
R1898:Myo5c UTSW 9 75297626 missense probably damaging 1.00
R2029:Myo5c UTSW 9 75289055 unclassified probably benign
R2063:Myo5c UTSW 9 75281868 missense probably benign 0.19
R2230:Myo5c UTSW 9 75273606 missense probably benign
R2519:Myo5c UTSW 9 75250436 missense probably damaging 1.00
R2520:Myo5c UTSW 9 75297649 nonsense probably null
R3034:Myo5c UTSW 9 75286577 missense probably benign 0.44
R3117:Myo5c UTSW 9 75266194 critical splice donor site probably null
R3432:Myo5c UTSW 9 75263001 missense probably damaging 1.00
R3751:Myo5c UTSW 9 75276002 missense probably damaging 1.00
R4132:Myo5c UTSW 9 75252568 missense probably benign 0.00
R4173:Myo5c UTSW 9 75246258 missense probably damaging 1.00
R4239:Myo5c UTSW 9 75283942 missense probably benign 0.01
R4429:Myo5c UTSW 9 75294001 missense probably damaging 1.00
R4574:Myo5c UTSW 9 75269611 missense probably benign 0.00
R4791:Myo5c UTSW 9 75290916 missense probably damaging 1.00
R4804:Myo5c UTSW 9 75245024 missense probably damaging 1.00
R4819:Myo5c UTSW 9 75292202 missense probably damaging 0.97
R4881:Myo5c UTSW 9 75284152 missense probably benign 0.00
R4900:Myo5c UTSW 9 75273543 missense probably damaging 1.00
R4964:Myo5c UTSW 9 75297509 missense possibly damaging 0.51
R4966:Myo5c UTSW 9 75269596 missense probably benign 0.03
R5057:Myo5c UTSW 9 75300873 missense probably damaging 1.00
R5347:Myo5c UTSW 9 75295205 missense probably null 1.00
R5399:Myo5c UTSW 9 75288074 missense possibly damaging 0.80
R5440:Myo5c UTSW 9 75258125 missense possibly damaging 0.91
R5569:Myo5c UTSW 9 75273510 missense probably damaging 1.00
R5600:Myo5c UTSW 9 75289154 missense probably benign 0.00
R5606:Myo5c UTSW 9 75275508 missense probably damaging 1.00
R5704:Myo5c UTSW 9 75272903 missense probably benign 0.00
R5798:Myo5c UTSW 9 75284198 missense probably benign 0.04
R5865:Myo5c UTSW 9 75297488 missense probably damaging 0.97
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6143:Myo5c UTSW 9 75249809 missense probably damaging 1.00
R6242:Myo5c UTSW 9 75273611 missense probably benign
R6253:Myo5c UTSW 9 75245037 missense probably damaging 1.00
R6264:Myo5c UTSW 9 75275554 missense probably benign
R6307:Myo5c UTSW 9 75272916 missense possibly damaging 0.73
R6358:Myo5c UTSW 9 75296012 missense possibly damaging 0.53
R6450:Myo5c UTSW 9 75286578 missense probably benign 0.26
R6598:Myo5c UTSW 9 75246234 missense probably damaging 1.00
R6618:Myo5c UTSW 9 75275637 critical splice donor site probably null
R6774:Myo5c UTSW 9 75289186 missense probably benign 0.05
R6865:Myo5c UTSW 9 75269596 missense probably benign 0.03
R6996:Myo5c UTSW 9 75250464 missense probably benign 0.01
R7023:Myo5c UTSW 9 75301456 missense probably damaging 0.98
R7123:Myo5c UTSW 9 75289223 missense probably benign
R7250:Myo5c UTSW 9 75262215 missense probably damaging 1.00
R7316:Myo5c UTSW 9 75269638 missense probably benign 0.00
R7340:Myo5c UTSW 9 75289141 missense probably benign
R7382:Myo5c UTSW 9 75304050 missense probably damaging 1.00
R7426:Myo5c UTSW 9 75251527 splice site probably null
R7788:Myo5c UTSW 9 75279345 missense probably damaging 0.98
Z1088:Myo5c UTSW 9 75245059 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tgaggaagcagagagagagag -3'
Posted On2014-05-16